3d news rss, rss , rss , rss, rss , rss , rss , rss, rss , rss , rss, rss , rss , yandex rss, rss, rss, lenta rss, rss yandex, rss , rss , rss lenta ru, rss, pikabu rss, rss , rss , rss , rss , rss, ixbt rss, rss , rss , rss, rss, rss , , lenta ru rss, rss news, rss , rss , rss xml, rss yandex , rss , rss, ria rss, rss , rss , forbes rss, rss ., rss , ria rss, rss , rss , rss , rss , rss , rss, rss , rss , rss , rss , rss , rss , kp.ru rss, , rss , rss , , tass rss , , mail ru rss , rss , , lenta.ru rss, news.yandex.ru rss, rbc rss, rss, rss, rss , rss, rss , rss , rss , rss , rss , rss , rss , rss , e1.ru rss, rss , yandex rss, rss , yandex news rss, rss , yandex rss , rss, rss , rss mail ru, rss , rss , , rss yandex , rss , rss , rss , rss , rss , , rss , rss, rss , rss , rss, rss , rss, rss , rss , rss , rss, rss , rss, rss , , rss , rss , rss.com, rss , rss , rss , rss , news rss, rss news, rss , rss , rss , rrs , rss online, rss , rss , rss , rss , rss , rss, rss , rss, rss , rss , rss, rss, rss , rss , rss , rss, rss.news.info, rss , rss , ria ru rss, rss , rss , , rss , rss , rss , ria.ru rss, rss, rss , rss , xml, rss , rss , rss , rss , rss, rss-, rss-, rss, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , bloomberg, , , , , , , , , , , , , , , , , , , , , , , , , , , -, , , , , , , , , , , , , rss , rss , rss , rss , rss, rss-, rss-, rss, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ura, , , , , , , , , , , , , -, , , , , , , , , , ,
 Wolfram Blog, 30
News, Views and Insights from Wolfram

1. Launching Version 13.1 of Wolfram Language & Mathematica ???, 30 [-/+]
(?)  (?)

The Epic Continues...

Last week it was 34 years since the original launch of Mathematica and whats now the Wolfram Language. And through all those years weve energetically continued building further and further, adding ever more capabilities, and steadily extending the domain of the computational paradigm.

In recent years weve established something of a rhythm, delivering the fruits of our development efforts roughly twice a year. We released Version 13.0 on December 13, 2021. And now, roughly six months later, were releasing Version 13.1. As usual, even though its a .1 release, its got a lot of new (and updated) functionality, some of which weve worked on for many years but finally now brought to fruition. (0)

2. New in 13: Geometric Computation, 24 [-/+]
(?)  (?)
Two years ago we released Version 12.0 of the Wolfram Language. Here are the updates in geometric computation since then, including the latest features in 13.0. The contents of this post are compiled from Stephen Wolfram s Release Announcements for 12.1, 12.2, 12.3 and 13.0. Euclidean Geometry Goes Interactive (December 2020) One of the major advances in Version 12.0 was the introduction of a symbolic representation for Euclidean geometry: you specify a symbolic GeometricScene , giving a variety of objects and constraints, and the Wolfram Language can solve it, and draw a diagram of a random instance that satisfies the constraints. In Version 12.2 weve made this interactive, so you can move the points in the diagram around, and everything will (if possible) interactively be rearranged so as to maintain the constraints. Here s a random instance of a simple geometric scene: #10005 RandomInstance[ GeometricScene[{a, b, c, d}, {CircleThrough[{a, b, c}, d], Triangle[{a, b, c}], d== Midpoint[{a, c}]}]] If you move one of the points, the other points will interactively be rearranged so as to maintain the constraints defined in the symbolic representation of the geometric scene: #10005 RandomInstance[ GeometricScene[{a, b, c, d}, {CircleThrough[{a, b, c}, d], Triangle[{a, b, c}], d== Midpoint[{a, c}]}]] Whats really going on inside here? Basically, the geometry is getting converted to algebra. And if you want, you can get the algebraic formulation: #10005 %["AlgebraicFormulation"] And, needless to say, you can manipulate this using the many powerful algebraic computation capabilities of the Wolfram Language. In addition to interactivity, another major new feature in 12.2 is the ability to handle not just complete geometric scenes, but also geometric constructions that involve building up a scene in multiple steps. Heres an example that happens to be taken directly from Euclid: #10005 RandomInstance[GeometricScene[ {{\[FormalCapitalA], \[FormalCapitalB], \[FormalCapitalC], \ \[FormalCapitalD], \[FormalCapitalE], \[FormalCapitalF]}, {}}, { GeometricStep[{Line[{\[FormalCapitalA], \[FormalCapitalB]}], Line[{\[FormalCapitalA], \[FormalCapitalC]}]}, "Define an arbitrary angle BAC."], GeometricStep[{\[FormalCapitalD] \[Element] Line[{\[FormalCapitalA], \[FormalCapitalB]}], \[FormalCapitalE] \ \[Element] Line[{\[FormalCapitalA], \[FormalCapitalC]}], EuclideanDistance[\[FormalCapitalA], \[FormalCapitalD]]== EuclideanDistance[\[FormalCapitalA], \[FormalCapitalE]]}, "Put D and E on AB and AC equidistant from A."], GeometricStep[{Line[{\[FormalCapitalD], \[FormalCapitalE]}], GeometricAssertion[{\[FormalCapitalA], \[FormalCapitalF]}, \ {"OppositeSides", Line[{\[FormalCapitalD], \[FormalCapitalE]}]}], GeometricAssertion[ Triangle[{\[FormalCapitalE], \[FormalCapitalF], \ \[FormalCapitalD]}], "Equilateral"], Line[{\[FormalCapitalA], \[FormalCapitalF]}]}, "Construct an equilateral triangle on DE."] } ]] The first image you get is basically the result of the construction. And like all other geometric scenes its now interactive. But if you mouse over it, youll get controls that allow you to move to earlier steps: #10005 Move a point at an earlier step, and youll see what consequences that has for later steps in the construction. Euclid s geometry is the very first axiomatic system for mathematics that we know about. So 2000+ years later it s exciting that we can finally make it computable. (And, yes, it will eventually connect up with AxiomaticTheory , FindEquationalProof , etc.) But in recognition of the significance of Euclid s original formulation of geometry, weve added computable versions of his propositions (as well as a bunch of other famous geometric theorems). The example above turns out to be proposition 9 in Euclids book 1. And now, for example, we can get his original statement of it in Greek: #10005 Entity["GeometricScene", "EuclidBook1Proposition9"]["GreekStatement"] And here it is in modern Wolfram Language in a form that can be understood by both computers and humans: #10005 Entity["GeometricScene", "EuclidBook1Proposition9"]["Scene"] Euclid Meets Descartes (May 2021) Weve been doing a lot with geometry in the past few years, and theres more to come. In Version 12.0 we introduced Euclid-style synthetic geometry. In Version 12.3 were connecting to Descartes-style analytic geometry, converting geometric descriptions to algebraic formulas. Given three symbolically specified points, GeometricTest can give the algebraic condition for them to be collinear: #10005 GeometricTest[{{a, b}, {c, d}, {e, f}}, "Collinear"] For the particular case of collinearity, theres a specific function for doing the test: #10005 CollinearPoints[{{a, b}, {c, d}, {e, f}}] But GeometricTest is much more general in scopesupporting more than 30 kinds of predicates. This gives the condition for a polygon to be convex: #10005 GeometricTest[Polygon[{{a, b}, {1, 2}, {3, 3}, {4, 7}}], "Convex"] And this gives the condition for a polygon to be regular: #10005 GeometricTest[Polygon[{{a, b}, {c, d}, {1, 1}, {2, 3}}], "Regular"] And heres the condition for three circles to be mutually tangent (and, yes, that ? is a little post Descartes): #10005 GeometricTest[{Circle[{0, 0}, r], Circle[{a, b}, s], Circle[{c, d}, t]}, "Tangent"] Version 12.3 also has enhancements to core computational geometry. Most notable are RegionDilation and RegionErosion , that essentially convolve regions with each other. RegionDilation effectively finds the whole (Minkowski sum) union region obtained by translating one region to every point in another region. Why is this useful? It turns out there are lots of reasons. One example is the piano mover problem (AKA the robot motion planning problem). Given, say, a rectangular shape, is there a way to maneuver it (in the simplest case, without rotation) through a house with certain obstacles (like walls)? Basically what you need to do is take the rectangular shape and dilate the room (and the obstacles) with it: #10005 RegionDilation[\!\(\* GraphicsBox[ TagBox[ DynamicModuleBox[{Typeset`mesh= HoldComplete[ BoundaryMeshRegion[{{0., 0.}, {0.11499999999999999`, 0.}, { 0.11499999999999999`, 0.22999999999999998`}, {0., 0.22999999999999998`}}, { Line[{{1, 2}, {2, 3}, {3, 4}, {4, 1}}]}, Method -> { "EliminateUnusedCoordinates" -> True, "DeleteDuplicateCoordinates" -> Automatic, "DeleteDuplicateCells" -> Automatic, "VertexAlias" -> Identity, "CheckOrientation" -> Automatic, "CoplanarityTolerance" -> Automatic, "CheckIntersections" -> Automatic, "BoundaryNesting" -> {{0, 0}}, "SeparateBoundaries" -> False, "TJunction" -> Automatic, "PropagateMarkers" -> True, "ZeroTest" -> Automatic, "Hash" -> 740210533488462839}]]}, TagBox[GraphicsComplexBox[{{0., 0.}, {0.11499999999999999`, 0.}, { 0.11499999999999999`, 0.22999999999999998`}, {0., 0.22999999999999998`}}, {Hue[0.6, 0.3, 0.95], EdgeForm[Hue[0.6, 0.3, 0.75]], TagBox[PolygonBox[{{1, 2, 3, 4}}], Annotation[#, "Geometry"]& ]}], MouseAppearanceTag["LinkHand"]], AllowKernelInitialization->False], "MeshGraphics", AutoDelete->True, Editable->False, Selectable->False], DefaultBaseStyle->{ "MeshGraphics", FrontEnd`GraphicsHighlightColor -> Hue[0.1, 1, 0.7]}, ImageSize->{27.866676879084963`, Automatic}]\), CloudGet["http://wolfr.am/VAs8Qsr5"]] Then if theres a connected path left over from one point to another, then its possible to move the piano along that path. (And of course, the same kind of thing can be done for robots in a factory, etc. etc.) RegionDilation is also useful for smoothing out or offsetting shapes, for example, for CAD applications: #10005 Region[RegionDilation[Triangle[], Disk[]]] At least in simple cases, one can go Descartes with it, and get explicit formulas: #10005 RegionDilation[Triangle[], Disk[]] And, by the way, this all works in any number of dimensionsproviding a useful way to generate all sorts of new shapes (like a cylinder is the dilation of a disk by a line in 3D). Geometric Regions: Fitting and Building (December 2021) Given a bunch of points on a circle, what is the circle they are on? Here are random points selected around a circle: #10005 The new function RegionFit can figure out what circle the points are on: #10005 Heres a collection of points in 3D: #10005 This fits a cylinder to these points: #10005 Another very useful new function in Version 13.0 is ConcaveHullMesh which attempts to reconstruct a surface from a collection of 3D points. Here are 1000 points: #10005 The convex hull will put shrinkwrap around everything: #10005 But the concave hull will make the surface go into the concavities: #10005 Theres a lot of freedom in how one can reconstruct the surface. Another function in Version 13 is GradientFittedMesh , which forms the surface from a collection of inferred surface normals: #10005 Weve just talked about finding geometric regions from point data. Another new capability in Version 13.0 is constructive solid geometry (CSG), which explicitly builds up regions from geometric primitives. The main function is CSGRegion , which allows a variety of operations to be done on primitives. Heres a region formed from an intersection of primitives: #10005 Note that this is an exact regionno numerical approximation is involved. So when we ask for its volume, we get an exact result: #10005 One can build up more complicated structures hierarchically: #10005 Though the integrals get difficult, its still often possible to get exact results for things like volume: #10005 Given a hierarchically constructed geometric region, its possible to tree it out with CSGRegionTree : #10005 In doing mechanical engineering, its very common to make parts by physically performing various operations that can easily be represented in CSG form. So here for example is a slightly more complicated CSG tree #10005 which can be assembled into an actual CSG region for a typical engineering part: #10005 Thinking about CSG highlights the question of determining when two regions are the same. For example, even though a region might be represented as a general Polygon , it may actually also be a pure Rectangle . And more than that, the region might be at a different place in space, with a different orientation. In Version 13.0 the function RegionCongruent tests for this: #10005 RegionSimilar also allows regions to change size: #10005 But knowing that two regions are similar, the next question might be: What transformation is needed to get from one to the other? In Version 13.0, FindRegionTransform tries to determine this: #10005 The Calculus of Annotations (March 2020) How do you add metadata annotations to something youre computing with? For Version 12.1 weve begun rolling out a general framework for making annotations and then computing with and from them. Another kind of structure that can be annotated just like graphs is a mesh. This is saying to annotate dimension-0 boundary cells with a style: #10005 Annotate[{MengerMesh[2], {0, "Boundary"}}, MeshCellStyle -> Red] div.bottomstripe { max-width:620px; margin-bottom:10px; background-color: #fff39a; border: solid 2px #ffd400; padding: 7px 10px 7px 10px; line-height: 1.2;} div.bottomstripe a, #blog .post_content .bottomstripe a:link, #blog .post_content .bottomstripe a:visited { font-family:"Source Sans Pro",Arial,Sans Serif; font-size:11pt; color:#aa0d00;} div.bottomstripe.purple { background-color: #f7f2ff; border: solid 2px #e4d9f4;} div.bottomstripe.purple a, #blog .post_content .bottomstripe.purple a:link, #blog .post_content .bottomstripe.purple a:visited { color:#531368;} This Wolfram U computational explorations course examines a range of disciplines not traditionally associated with coding. (0)

3. New in 13: Cloud & Webpage Construction, 16 [-/+]
(?)  (?)
Two years ago we released Version 12.0 of the Wolfram Language. Here are the updates in cloud and webpage construction since then, including the latest features in 13.0. The contents of this post are compiled from Stephen Wolfram s Release Announcements for 12.1, 12.2, 12.3 and 13.0. WSTPServer: A New Deployment of Wolfram Engine (December 2020) Our long-term goal is to make the Wolfram Language and the computational intelligence it provides as ubiquitous as possible. And part of doing this is to set up the Wolfram Engine which implements the language so that it can be deployed in as broad a range of computational infrastructure settings as possible. Wolfram Desktop as well as classic Mathematica primarily provides a notebook interface to the Wolfram Engine, running on a local desktop system. It s also possible to run Wolfram Engine directly as a command-line program (e.g. through WolframScript ) on a local computer system. And, of course, one can run the Wolfram Engine in the cloud, either through the full Wolfram Cloud (public or private), or through more lightweight cloud and server offerings (both existing and forthcoming). But with Version 12.2 theres a new deployment of the Wolfram Engine: WSTPServer. If you use Wolfram Engine in the cloud, youre typically communicating with it through http or related protocols. But for more than thirty years, the Wolfram Language has had its own dedicated protocol for transferring symbolic expressions and everything around them. Originally we called it MathLink, but in more recent years, as it s progressively been extended, weve called it WSTP: the Wolfram Symbolic Transfer Protocol. What WSTPServer does, as its name suggests, is to give you a lightweight server that delivers Wolfram Engines and lets you communicate with them directly in native WSTP. Why is this important? Basically because it gives you a way to manage pools of persistent Wolfram Language sessions that can operate as services for other applications. For example, normally each time you call WolframScript you get a new, fresh Wolfram Engine. But by using wolframscript -wstpserver with a particular WSTP profile name you can keep getting the same Wolfram Engine every time you call WolframScript. You can do this directly on your local machine or on remote machines. And an important use of WSTPServer is to expose pools of Wolfram Engines that can be accessed through the new RemoteEvaluate function in Version 12.2. Its also possible to use WSTPServer to expose Wolfram Engines for use by ParallelMap , etc. And finally, since WSTP has (for nearly 30 years!) been the way the notebook front end communicates with the Wolfram Engine kernel, its now possible to use WSTPServer to set up a centralized kernel pool to which you can connect the notebook front end, allowing you, for example, to keep running a particular session (or even a particular computation) in the kernel even as you switch to a different notebook front end, on a different computer. CloudExpression Goes Mainstream (December 2021) Youve got an expression you want to manipulate across sessions. One way to do this is to make the whole expression persistent using PersistentValue or explicitly store it in a file or a cloud object and read it back when you need it. But theres a much more efficient and seamless way to do thisthat doesnt require you to deal with the whole expression all the time, but instead lets you poke and peek at individual partsand thats to use CloudExpression . We first introduced CloudExpression back in 2016 in Version 10.4. At that time it was intended to be a fairly temporary way to store fairly small expressions. But weve found that its a lot more generally useful than we expected, and so in Version 13.0 its getting a major upgrade that makes it more efficient and robust. Its worth mentioning that there are several other ways to store things persistently in the Wolfram Language. You can use PersistentValue to persist whole expressions. You can use Wolfram Data Drop functionality to let you progressively add to databins. You can use ExternalStorageUpload to store things in external storage systems like S3 or IPFS. Or you can set up an external database (like an SQL- or document-based one), and then use Wolfram Language functions to access and update this. But CloudExpression provides a much more lightweight, yet general, way to set up and manipulate persistent expressions. The basic idea is to create a cloud expression that is stored persistently in your cloud account, and then to be able to do operations on that expression. If the cloud expression consists of lists and associations, then standard Wolfram Language operations let you efficiently read or write parts of the cloud expression without ever having to pull the whole thing into memory in your session. This creates a cloud expression from a table of, in this case, polynomials: #10005 This gives us the 5th part of the table: #10005 We can reset it: #10005 This gets the whole cloud expression: #10005 But the important point is that getting and setting parts of the cloud expression dont require pulling the expression into memory. Each operation is instead done directly in the cloud. In a traditional relational database system, thered have to be a certain rectangularity to the data. But in a cloud expression (like in a NoSQL database) you can have any nested list and association structure, and, in addition, the elements can be arbitrary symbolic expressions. CloudExpression is set up so that operations you use are atomic, so that, for example, you can safely have two different processes concurrently reading and writing to the same cloud expression. The result is that CloudExpression is a good way to handle data built up by things like APIFunction and FormFunction . By the way, CloudExpression is ultimately in effect just a cloud object, so it shares permission capabilities with CloudObject . And this means, for example, that you can let other people reador writeto a cloud expression you created. (The data associated with CloudExpression is stored in your cloud account, though it uses its own storage quota, separate from the one for CloudObject .) Lets say you store lots of important data as a sublist in CloudExpression . CloudExpression is so easy to use, you might worry that youd just type something like ce["customers"]=7 and suddenly your critical data would be overwritten. To avoid this, CloudExpression has the option PartProtection , which allows you to specify whether, for example, you want to allow the structure of the expression to be changed, or only its leaf elements. Symbolic Webpage Construction (December 2021) If you want to take a notebook and turn it into a webpage, all you need do is CloudPublish it. Similarly, if you want to create a form on the web, you can just use CloudPublish with FormFunction (or FormPage ). And there are a variety of other direct-to-web capabilities that have long been built into the Wolfram Language. But what if you want to make a webpage with elaborate web elements? One way is to use XMLTemplate to insert Wolfram Language output into a file of HTML etc. But in Version 13.0 were beginning the process of setting up symbolic specifications of full webpage structure, that let you get the best of both Wolfram Language and web capabilities and frameworks. Heres a very small example: #10005 And heres the webpage it produces: The basic idea is to construct webpages using nested combinations of WebColumn , WebRow and WebItem . Each of these have various Wolfram Language options. But they also allow direct access to CSS options. So in addition to a Wolfram Language Background-> LightBlue option, you can also use a CSS option like "border-right"->"1px solid #ddd". Theres one additional critical feature: InterfaceSwitched . This is the core of being able to create responsive webpages that can change their structure when viewed on different kinds of devices. InterfaceSwitched is a symbolic construct that you can insert anywhere inside WebItem , WebColumn , etc. and that can behave differently when accessed with a different interface. So, for example #10005 will behave as 1 if its accessed from a device with a width between 0 and 480 pixels, and so on. You can see this in action using CloudPublish #10005 and then just resizing the window you use to view the result: div.bottomstripe { max-width:620px; margin-bottom:10px; background-color: #fff39a; border: solid 2px #ffd400; padding: 7px 10px 7px 10px; line-height: 1.2;} div.bottomstripe a, #blog .post_content .bottomstripe a:link, #blog .post_content .bottomstripe a:visited { font-family:"Source Sans Pro",Arial,Sans Serif; font-size:11pt; color:#aa0d00;} div.bottomstripe.purple { background-color: #f7f2ff; border: solid 2px #e4d9f4;} div.bottomstripe.purple a, #blog .post_content .bottomstripe.purple a:link, #blog .post_content .bottomstripe.purple a:visited { color:#531368;} Want more help? Register for one of Wolfram Us Daily Study Groups. (0)

4. New in 13: Data & Function Repositories, 10 [-/+]
(?)  (?)

Two years ago we released Version 12.0 of the Wolfram Language. Here are the updates to the Data and Function Repositories since then, including the latest features in 13.0. The contents of this post are compiled from Stephen Wolfram’s Release Announcements for 12.1, 12.2, 12.3 and 13.0.

Making the Data Repository Easy (March 2020)

We launched the Wolfram Function Repository in June 2019, and there are already 1146 functions published in it. One of the innovations in the Function Repository is a very streamlined process for submitting new functions, applicable both for the public Function Repository, and for individual deployment on a single machine, or in the cloud.

In Version 12.1 were introducing a new, streamlined submission mechanism for the Data Repository. File > New > Repository Item > Data Repository Item gives you:

Data Resource Definition Notebook

Then if youve got, say, a Dataset, you just insert it in the notebook, then add examples (using the Insert ResourceObject button to insert references to the object youre creating). When youre done, press Deploy, and you can deploy locally, or privately or publicly to the cloud. Lots of checking just happens automatically (and if theres something wrong youll usually get a suggestion about how to fix it).

My goal was to make it so that a simple Data Repository entry could be created in just a few minutes, and I think weve streamlined and automated things to the point where thats now possible.

The Advance of the Function Repository (December 2021)

When we launched the Wolfram Function Repository in 2019 we didnt know how rapidly it would grow. But Im happy to say that its been a great successwith perhaps 3 new functions per day being published, giving a total to date of 2259 functions. These are functions which are not part of the core Wolfram Language, but can immediately be accessed from any Wolfram Language system.

They are functions contributed by members of the community, and reviewed and curated by us. And given all of the capabilities of the core Wolfram Language its remarkable what can be achieved in a single contributed function. The functions mostly dont have the full breadth and robustness that would be needed for integration into the core Wolfram Language (though functions like Adjugate in Version 13.0 were developed from prototypes in the Function Repository). But what they have is a greatly accelerated delivery process which allows convenient new functionality in new areas to be made available extremely quickly.

Some of the functions in the Function Repository extend algorithmic capabilities. An example is FractionalOrderD for computing fractional derivatives:


Theres a lot in FractionalOrderD. But its in a way quite specificin the sense that its based on one particular kind of fractional differentiation. In the future we may build into the system full-scale fractional differentiation, but this requires a host of new algorithms. What FractionalOrderD in the Function Repository does is to deliver one form of fractional differentiation now.

Heres another example of a function in the Function Repository, this time one thats based on capabilities in Wolfram|Alpha:


Another similar example is:


Some functions provide extended visualization capabilities. Heres VennDiagram:


There are many ways to imagine handling more complicated cases; this function makes a particular choice:


As another example of a visualization function, heres TruthTablebuilt to give a visual display of the results of the core language BooleanTable function:


Some functions give convenientthough perhaps not entirely generalextensions to particular features of the language. Heres IntegerChop that reduces real numbers sufficiently close to integers to exact integers:


Heres an example of a function that perhaps one day will be in the core language. But for now the most common cases of it are provided by a Function Repository function:


There are lots of functions in the Function Repository that give specific extensions to areas of functionality in the core language. BootstrappedEstimate, for example, gives a useful, specific extension to statistics functionality:


Heres a function that remaps the Mandelbrot setusing FunctionCompile to go further than MandelbrotSetPlot:


There are some functions that definitely seem nichebut are extremely useful if you need them:


Then there are functions that make current issues convenient. An example is MintNFT:


There are also functions for fun (that can definitely also be useful):


And there are functions that might be considered insider humor:


By the way, its not just the Function Repository thats been growing with all sorts of great contributions: theres also the Data Repository and Neural Net Repository, which have also been energetically advancing.

Visit the Wolfram Function Repository to embark on your own computational adventures!

5. Computational Art: 2022 Wolfram Language Winners, 02 [-/+]
(?)  (?)

Computational Art: 2022 Wolfram Language Winners

The Wolfram Language is incredibly versatile, and while it is most closely associated with mathematics, it has powerful features in a range of areas. As a challenge to our users on Wolfram Community, the 2022 Wolfram Computational Art Contest prompted participants to use Wolfram technology to flex their creativity to generate art.

The requirements for submissions were:

  • A brief Community post featuring the final art piece
  • The code used to create the piece
  • An explanation of this code

Three Wolfram staff members volunteered to judge the 35 submissions, based upon four criteria:

  • Visual aesthetics
  • Wolfram Language code
  • Creativity
  • Explanation of process

After much debate, the judges picked four winners and one honorable mention.

And the Winners Are…

Honorable Mention

Daniel Hoffmann: The Memory of Persistence

Initially, this contest did not include an honorable mention. With a close margin in scores and some contention among the judges, however, one was added to include this reflection on time. Inspired by surrealist Salvador Dalis famous painting The Persistence of Memory, the judges agreed this was a well-done piece, both artistically and computationally, deserving mention even if it did not ultimately place in the top three.

The Memory of Persistence


Each output creates a random design with different clock sizes, patterns and colors for a unique interpretation every time.

The Memory of Persistence

Staff Winner

Anton Antonov: Rorschach Mask Animations Projected over 3D Surfaces

Unlike some other Wolfram contests, such as the annual One-Liner Competition, former or current employees were allowed to participate in this contest as a separate category. This piece looked at recreating a visual similar to Rorschachs mask from the 2009 movie Watchmen. The resulting masks are pretty trippy!

Rorschach mask animations

Antonov created several unique environments to display his piece, including cloth samples to build a wallpaper design:

clothOriginal= ImageAdjust

Third Place

Jacqueline Doan: Kuramoto Oscillators with Phase Lag

Third place was actually inspired by another computational art event.

When I was planning an event for my universitys math club, one of my friends suggested that we host a generative art event, where guests can come and plot their own chaotic attractors; this was when I was introduced to generative art, explained Jacqueline Doan. I originally wanted to be a graphic designer, so you can imagine my excitement when I found out a way to combine my two interests: math and art.

Actually composed of two pieces titled KM and Focus, this entry leverages the Kuramoto model, used to describe the synchronicity of coupled oscillators, and visualizes the oscillators trajectories. Doan said this was their first time making generative art and that they want to make more. Were looking forward to getting to see these future works!

Second Place

Tom Verhoeff: Sculpture from 18 Congruent Pieces

In the words of our judges, our second-place winner was deceptively simple at first glance, but fascinating after seeing the design process. The crux of this entry was based upon creating a pretty 3D polygon as explored by Tom Verhoeff and Melissa van Veenendaal in an article for the Bridges conference about mathematics and arts. The sculptures construction, composed of 18 beams with specific relationships to each other, leverages many of the powerful features of the Wolfram Language: symbolic computations, numeric computations, graph plotting, 3D graphics and interactive manipulations. The complexity of this shape is revealed in its rotations, such as its flamingo posture. Check out the full Wolfram Community post to play around with these rotations yourself!

First Place

Frederick Wu: Love Heart Jewelry IV: The Giving Tree

Last, but certainly not least, our first-place winner! This one was a judge favorite all around. The fourth part in a series of posts (one of which was previously featured on the Wolfram Blog), this piece moves from the computational realm into the physical. Using a casting process, the 3D geometry was turned into a pendant, and as with other creations from this series, gifted to the creators family. Combining computational design, metalworking and a story about family and love, this entry not only ticked the boxes for this competitions but was also a heartwarming read.

Frederick Wu then rendered this masterpiece into a mold to 3D print and cast silver to create a pendant for his daughters. Want your own 3D Spikey? You can use his code to create an STL file to then upload to 3D-printing software:

3D image render

Get Creative!

Even though the contest has wrapped, that doesnt mean you cant try your hand at some computational art. If you need some inspiration beyond these winners, check out all the great submissions from Wolfram Community!

Visit Wolfram Community or the Wolfram Function Repository to embark on your own computational adventures!

6. New in 13: Molecules & Biomolecular Sequences, 27 [-/+]
(?)  (?)

Two years ago we released Version 12.0 of the Wolfram Language. Here are the updates in molecules and biomolecular sequences since then, including the latest features in 13.0. The contents of this post are compiled from Stephen Wolfram’s Release Announcements for 12.1, 12.2, 12.3 and 13.0.

What Is That Molecule? Advances in Chemical Computation (March 2020)

You have an image of a molecular structure diagram, say from a paper. But how can you get the molecule it represents in a computable form? Well, with Version 12.1 all you need do is use MoleculeRecognize:



Its the analog of TextRecognize, but for molecules. And what it produces is a Wolfram Language symbolic representation of the molecule. So, for example, you can then generate a 3D structure:

mol= MoleculeRecognize

mol= MoleculeRecognize[CloudGet["https://wolfr.am/L9rL9B2K"]];



Or you can compute the distribution of torsion angles of the structure:


Histogram[MoleculeValue[mol, "TorsionAngle"], 360]

You can also connect to the world of external identifiers:


MoleculeValue[mol, "PubChemCompoundID"]

But whats really useful about MoleculeRecognize is that it can be used programmatically. Take all the images of chemicals from a paper, molecule OCR them—then do things like check whether the molecules are equivalent, or make a word cloud of their 3D structures:


 MoleculePlot3D /@ DeleteDuplicates[MoleculeRecognize[{\!\(\*
"], {{0, 166.}, {
 233., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSizeRaw->{233., 166.},
PlotRange->{{0, 233.}, {0, 166.}}]\), \!\(\*
"], {{0, 161.}, {
 256., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSize->{60.703125, Automatic},
ImageSizeRaw->{256., 161.},
PlotRange->{{0, 256.}, {0, 161.}}]\), \!\(\*
"], {{0, 199.}, {280., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSizeRaw->{280., 199.},
PlotRange->{{0, 280.}, {0, 199.}}]\), \!\(\*
"], {{0, 241.}, {300., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSize->{50.24609375, Automatic},
ImageSizeRaw->{300., 241.},
PlotRange->{{0, 300.}, {0, 241.}}]\), \!\(\*
"], {{0, 166.}, {264., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSizeRaw->{264., 166.},
PlotRange->{{0, 264.}, {0, 166.}}]\), \!\(\*
"], {{0, 154.}, {225., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSizeRaw->{225., 154.},
PlotRange->{{0, 225.}, {0, 154.}}]\), \!\(\*
"], {{0, 88.}, {83., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSize->{46.51171874999994, Automatic},
ImageSizeRaw->{83., 88.},
PlotRange->{{0, 83.}, {0, 88.}}]\), \!\(\*
"], {{
 0, 72.}, {189., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSizeRaw->{189., 72.},
PlotRange->{{0, 189.}, {0, 72.}}]\), \!\(\*
"], {{0, 98.}, {221., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSizeRaw->{221., 98.},
PlotRange->{{0, 221.}, {0, 98.}}]\), \!\(\*
"], {{0, 254.}, {264., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSize->{40.73046875, Automatic},
ImageSizeRaw->{264., 254.},
PlotRange->{{0, 264.}, {0, 254.}}]\), \!\(\*
"], {{0, 154.}, {
 225., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSizeRaw->{225., 154.},
PlotRange->{{0, 225.}, {0, 154.}}]\), \!\(\*
"], {{0, 347.}, {373., 0}}, {0, 255},
BoxForm`ImageTag["Byte", ColorSpace -> "RGB", Interleaving -> True],
ImageSize->{57.40625, Automatic},
ImageSizeRaw->{373., 347.},
PlotRange->{{0, 373.}, {0, 347.}}]\), 
 CloudGet["https://wolfr.am/KR7FBcsM"]}], MoleculeEquivalentQ]]

Something else thats new in 12.1—and a first sign of something big to come—is the ability to import data about molecular orbitals:


Import["ExampleData/Pyridinecarbonitrile_MO_25_29.cub", "Graphics3D"]

More in Chemistry (May 2021)

Chemistry is a major new area for Wolfram Language. In Version 12.0 we introduced Molecule as a symbolic representation of a molecule, and weve steadily been expanding what can be done with it.

In Version 12.3, for example, there are new properties for Molecule, like "TautomerList" (possible reconfigurations in solution):


MoleculePlot /@ Molecule[{"C", 
Atom["C", "HydrogenCount" -> 1], "C", "O", "N", "C", "C", "O", "O", 
 "N"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{3, 4}, "Double"], 
Bond[{3, 5}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{6, 7}, "Single"], 
Bond[{7, 8}, "Double"], 
Bond[{7, 9}, "Single"], 
Bond[{2, 10}, "Single"]}, {StereochemistryElements -> {
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 2, "Direction" -> 

There are also convenience functions like MoleculeName:



And, yes, with MoleculeRecognize you can just clip a structure diagram from a publication and find the name of the molecule:



Given a collection of molecules, a question one often wants to ask is Whats in common between these molecules? In Version 12.3 we now have the function MoleculeMaximumCommonSubstructure, which is the molecular structure analog of LongestCommonSubsequence:


mcs= MoleculeMaximumCommonSubstructure[{Molecule[{
 "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
 "C", "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{13, 16}, "Single"], 
Bond[{16, 17}, "Single"], 
Bond[{16, 18}, "Single"], 
Bond[{18, 19}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{18, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 20}, "Single"], 
Bond[{1, 21}, "Single"], 
Bond[{4, 22}, "Single"], 
Bond[{9, 23}, "Single"], 
Bond[{11, 24}, "Single"], 
Bond[{13, 25}, "Single"], 
Bond[{14, 26}, "Single"], 
Bond[{14, 27}, "Single"], 
Bond[{15, 28}, "Single"], 
Bond[{16, 29}, "Single"], 
Bond[{17, 30}, "Single"], 
Bond[{18, 31}, "Single"], 
Bond[{19, 32}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{32, 3}, {CompressedData["
"], "Angstroms", {{1}, {
 2}}}]], StereochemistryElements -> {
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, 
 "Direction" -> "Counterclockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, 
 "Direction" -> "Counterclockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 16, 
 "Direction" -> "Clockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 18, 
 "Direction" -> "Clockwise"]}}], 
 "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
 "C", "O", "P", "O", "O", "O", "P", "O", "O", "O", "P", "O", "O", 
 "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{15, 16}, "Single"], 
Bond[{16, 17}, "Double"], 
Bond[{16, 18}, "Single"], 
Bond[{16, 19}, "Single"], 
Bond[{19, 20}, "Single"], 
Bond[{20, 21}, "Double"], 
Bond[{20, 22}, "Single"], 
Bond[{20, 23}, "Single"], 
Bond[{23, 24}, "Single"], 
Bond[{24, 25}, "Double"], 
Bond[{24, 26}, "Single"], 
Bond[{24, 27}, "Single"], 
Bond[{13, 28}, "Single"], 
Bond[{28, 29}, "Single"], 
Bond[{28, 30}, "Single"], 
Bond[{30, 31}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{30, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 32}, "Single"], 
Bond[{1, 33}, "Single"], 
Bond[{4, 34}, "Single"], 
Bond[{9, 35}, "Single"], 
Bond[{11, 36}, "Single"], 
Bond[{13, 37}, "Single"], 
Bond[{14, 38}, "Single"], 
Bond[{14, 39}, "Single"], 
Bond[{18, 40}, "Single"], 
Bond[{22, 41}, "Single"], 
Bond[{26, 42}, "Single"], 
Bond[{27, 43}, "Single"], 
Bond[{28, 44}, "Single"], 
Bond[{29, 45}, "Single"], 
Bond[{30, 46}, "Single"], 
Bond[{31, 47}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{47, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 StereochemistryElements -> {
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, 
 "Direction" -> "Counterclockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, 
 "Direction" -> "Counterclockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 28, 
 "Direction" -> "Clockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 30, 
 "Direction" -> "Clockwise"]}}]}]

Heres a diagram of the common part:


 "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
 "C", "O", "P", "O", "O", "O", "P", "O", "O", "O", "P", "O", "O", 
 "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{15, 16}, "Single"], 
Bond[{16, 17}, "Double"], 
Bond[{16, 18}, "Single"], 
Bond[{16, 19}, "Single"], 
Bond[{19, 20}, "Single"], 
Bond[{20, 21}, "Double"], 
Bond[{20, 22}, "Single"], 
Bond[{20, 23}, "Single"], 
Bond[{23, 24}, "Single"], 
Bond[{24, 25}, "Double"], 
Bond[{24, 26}, "Single"], 
Bond[{24, 27}, "Single"], 
Bond[{13, 28}, "Single"], 
Bond[{28, 29}, "Single"], 
Bond[{28, 30}, "Single"], 
Bond[{30, 31}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{30, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 32}, "Single"], 
Bond[{1, 33}, "Single"], 
Bond[{4, 34}, "Single"], 
Bond[{9, 35}, "Single"], 
Bond[{11, 36}, "Single"], 
Bond[{13, 37}, "Single"], 
Bond[{14, 38}, "Single"], 
Bond[{14, 39}, "Single"], 
Bond[{18, 40}, "Single"], 
Bond[{22, 41}, "Single"], 
Bond[{26, 42}, "Single"], 
Bond[{27, 43}, "Single"], 
Bond[{28, 44}, "Single"], 
Bond[{29, 45}, "Single"], 
Bond[{30, 46}, "Single"], 
Bond[{31, 47}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{47, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 StereochemistryElements -> {
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, "Direction" -> 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, "Direction" -> 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 28, "Direction" -> 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 30, "Direction" -> 
 "Clockwise"]}}], %]

And now with MoleculeAlign we can see how the molecules actually align in 3D:


 "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
 "C", "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{13, 16}, "Single"], 
Bond[{16, 17}, "Single"], 
Bond[{16, 18}, "Single"], 
Bond[{18, 19}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{18, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 20}, "Single"], 
Bond[{1, 21}, "Single"], 
Bond[{4, 22}, "Single"], 
Bond[{9, 23}, "Single"], 
Bond[{11, 24}, "Single"], 
Bond[{13, 25}, "Single"], 
Bond[{14, 26}, "Single"], 
Bond[{14, 27}, "Single"], 
Bond[{15, 28}, "Single"], 
Bond[{16, 29}, "Single"], 
Bond[{17, 30}, "Single"], 
Bond[{18, 31}, "Single"], 
Bond[{19, 32}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{32, 3}, {CompressedData["
"], "Angstroms", {{1}, {
 2}}}]], StereochemistryElements -> {
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, 
 "Direction" -> "Counterclockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, 
 "Direction" -> "Counterclockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 16, 
 "Direction" -> "Clockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 18, 
 "Direction" -> "Clockwise"]}}], 
 "N", "C", "N", "C", "N", "C", "C", "N", "C", "N", "C", "O", "C", 
 "C", "O", "P", "O", "O", "O", "P", "O", "O", "O", "P", "O", "O", 
 "O", "C", "O", "C", "O", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Aromatic"], 
Bond[{3, 4}, "Aromatic"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{10, 11}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{13, 14}, "Single"], 
Bond[{14, 15}, "Single"], 
Bond[{15, 16}, "Single"], 
Bond[{16, 17}, "Double"], 
Bond[{16, 18}, "Single"], 
Bond[{16, 19}, "Single"], 
Bond[{19, 20}, "Single"], 
Bond[{20, 21}, "Double"], 
Bond[{20, 22}, "Single"], 
Bond[{20, 23}, "Single"], 
Bond[{23, 24}, "Single"], 
Bond[{24, 25}, "Double"], 
Bond[{24, 26}, "Single"], 
Bond[{24, 27}, "Single"], 
Bond[{13, 28}, "Single"], 
Bond[{28, 29}, "Single"], 
Bond[{28, 30}, "Single"], 
Bond[{30, 31}, "Single"], 
Bond[{7, 2}, "Aromatic"], 
Bond[{30, 11}, "Single"], 
Bond[{10, 6}, "Aromatic"], 
Bond[{1, 32}, "Single"], 
Bond[{1, 33}, "Single"], 
Bond[{4, 34}, "Single"], 
Bond[{9, 35}, "Single"], 
Bond[{11, 36}, "Single"], 
Bond[{13, 37}, "Single"], 
Bond[{14, 38}, "Single"], 
Bond[{14, 39}, "Single"], 
Bond[{18, 40}, "Single"], 
Bond[{22, 41}, "Single"], 
Bond[{26, 42}, "Single"], 
Bond[{27, 43}, "Single"], 
Bond[{28, 44}, "Single"], 
Bond[{29, 45}, "Single"], 
Bond[{30, 46}, "Single"], 
Bond[{31, 47}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{47, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 StereochemistryElements -> {
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 11, 
 "Direction" -> "Counterclockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 13, 
 "Direction" -> "Counterclockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 28, 
 "Direction" -> "Clockwise"], 
 "StereoType" -> "Tetrahedral", "ChiralCenter" -> 30, 
 "Direction" -> "Clockwise"]}}], mcs], mcs]

Given our strength in chemistry and in machine learning, were now in an interesting position to bring these fields together. And in Version 12.3 we have the beginnings of built-in chemical machine learning. Here are samples of two classes of chemicals:


acids= {Molecule[{
 "S", "O", "O", "C", "C", "C", "C", "C", "C", "C", "B", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 5}, "Single"], 
Bond[{1, 10}, "Single"], 
Bond[{2, 11}, "Single"], 
Bond[{2, 19}, "Single"], 
Bond[{3, 11}, "Single"], 
Bond[{3, 20}, "Single"], 
Bond[{4, 6}, "Aromatic"], 
Bond[{4, 7}, "Aromatic"], 
Bond[{4, 11}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 8}, "Aromatic"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 9}, "Aromatic"], 
Bond[{7, 13}, "Single"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 14}, "Single"], 
Bond[{9, 15}, "Single"], 
Bond[{10, 16}, "Single"], 
Bond[{10, 17}, "Single"], 
Bond[{10, 18}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{20, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", "B", 
 "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H"}, {
Bond[{1, 4}, "Single"], 
Bond[{1, 6}, "Single"], 
Bond[{2, 13}, "Single"], 
Bond[{2, 25}, "Single"], 
Bond[{3, 13}, "Single"], 
Bond[{3, 26}, "Single"], 
Bond[{4, 5}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{4, 15}, "Single"], 
Bond[{5, 8}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{5, 17}, "Single"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 13}, "Single"], 
Bond[{8, 18}, "Single"], 
Bond[{8, 19}, "Single"], 
Bond[{8, 20}, "Single"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{9, 21}, "Single"], 
Bond[{10, 12}, "Aromatic"], 
Bond[{10, 22}, "Single"], 
Bond[{11, 12}, "Aromatic"], 
Bond[{11, 23}, "Single"], 
Bond[{12, 24}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{26, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["

"]}], Molecule[{
 "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
 "C", "B", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H"}, {
Bond[{1, 10}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{2, 9}, "Single"], 
Bond[{3, 15}, "Single"], 
Bond[{3, 28}, "Single"], 
Bond[{4, 15}, "Single"], 
Bond[{4, 29}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{5, 7}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{5, 17}, "Single"], 
Bond[{6, 8}, "Single"], 
Bond[{6, 18}, "Single"], 
Bond[{6, 19}, "Single"], 
Bond[{7, 20}, "Single"], 
Bond[{7, 21}, "Single"], 
Bond[{8, 22}, "Single"], 
Bond[{8, 23}, "Single"], 
Bond[{8, 24}, "Single"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{10, 13}, "Aromatic"], 
Bond[{11, 14}, "Aromatic"], 
Bond[{11, 25}, "Single"], 
Bond[{12, 13}, "Aromatic"], 
Bond[{12, 14}, "Aromatic"], 
Bond[{12, 15}, "Single"], 
Bond[{13, 26}, "Single"], 
Bond[{14, 27}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{29, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 "O", "O", "O", "C", "C", "C", "C", "C", "C", "B", "H", "H", "H", 
 "H", "H", "H", "H"}, {
Bond[{1, 7}, "Single"], 
Bond[{1, 15}, "Single"], 
Bond[{2, 10}, "Single"], 
Bond[{2, 16}, "Single"], 
Bond[{3, 10}, "Single"], 
Bond[{3, 17}, "Single"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{4, 6}, "Aromatic"], 
Bond[{4, 10}, "Single"], 
Bond[{5, 8}, "Aromatic"], 
Bond[{5, 11}, "Single"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{7, 9}, "Aromatic"], 
Bond[{8, 13}, "Single"], 
Bond[{9, 14}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{17, 3}, {CompressedData["
"], "Angstroms", {{1}, {
 AtomDiagramCoordinates -> {{2.866, -2.405}, {3.7321, 2.095}, {2.,
 2.095}, {2.866, 0.595}, {3.7321, 0.095}, {2., 0.095}, {
 2.866, -1.405}, {3.7321, -0.905}, {2., -0.905}, {2.866, 
 1.595}, {4.269, 0.405}, {1.4631, 0.405}, {4.269, -1.215}, {
 1.4631, -1.215}, {2.3291, -2.715}, {3.7321, 2.715}, {2., 
 "O", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "B", 
 "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 5}, "Single"], 
Bond[{1, 11}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 12}, "Single"], 
Bond[{3, 13}, "Single"], 
Bond[{3, 23}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 24}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 8}, "Aromatic"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 13}, "Single"], 
Bond[{8, 14}, "Single"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{9, 15}, "Single"], 
Bond[{10, 16}, "Single"], 
Bond[{11, 17}, "Single"], 
Bond[{11, 18}, "Single"], 
Bond[{11, 19}, "Single"], 
Bond[{12, 20}, "Single"], 
Bond[{12, 21}, "Single"], 
Bond[{12, 22}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{24, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 "S", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "B", "H", 
 "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 5}, "Aromatic"], 
Bond[{1, 7}, "Aromatic"], 
Bond[{2, 12}, "Single"], 
Bond[{2, 18}, "Single"], 
Bond[{3, 12}, "Single"], 
Bond[{3, 19}, "Single"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{4, 6}, "Aromatic"], 
Bond[{4, 8}, "Aromatic"], 
Bond[{5, 9}, "Aromatic"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{6, 13}, "Single"], 
Bond[{7, 12}, "Single"], 
Bond[{8, 10}, "Aromatic"], 
Bond[{8, 14}, "Single"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{9, 15}, "Single"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 16}, "Single"], 
Bond[{11, 17}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{19, 3}, {CompressedData["
"], "Angstroms", {{
 1}, {2}}}]], AtomDiagramCoordinates -> CompressedData["
 "C", "C", "C", "C", "B", "O", "O", "C", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Double"], 
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{5, 7}, "Single"], 
Bond[{2, 8}, "Single"], 
Bond[{1, 9}, "Single"], 
Bond[{1, 10}, "Single"], 
Bond[{1, 11}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{6, 15}, "Single"], 
Bond[{7, 16}, "Single"], 
Bond[{8, 17}, "Single"], 
Bond[{8, 18}, "Single"], 
Bond[{8, 19}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{19, 3}, {CompressedData["
"], "Angstroms", {{
 1}, {2}}}]], AtomDiagramCoordinates -> CompressedData["
 "O", "O", "O", "N", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
 "C", "C", "B", "B", "B", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 16}, "Single"], 
Bond[{1, 17}, "Single"], 
Bond[{2, 16}, "Single"], 
Bond[{2, 18}, "Single"], 
Bond[{3, 17}, "Single"], 
Bond[{3, 18}, "Single"], 
Bond[{4, 11}, "Aromatic"], 
Bond[{4, 12}, "Aromatic"], 
Bond[{5, 13}, "Double"], 
Bond[{5, 16}, "Single"], 
Bond[{5, 19}, "Single"], 
Bond[{6, 14}, "Double"], 
Bond[{6, 17}, "Single"], 
Bond[{6, 20}, "Single"], 
Bond[{7, 15}, "Double"], 
Bond[{7, 18}, "Single"], 
Bond[{7, 21}, "Single"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 10}, "Aromatic"], 
Bond[{8, 22}, "Single"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{9, 23}, "Single"], 
Bond[{10, 12}, "Aromatic"], 
Bond[{10, 24}, "Single"], 
Bond[{11, 25}, "Single"], 
Bond[{12, 26}, "Single"], 
Bond[{13, 27}, "Single"], 
Bond[{13, 28}, "Single"], 
Bond[{14, 29}, "Single"], 
Bond[{14, 30}, "Single"], 
Bond[{15, 31}, "Single"], 
Bond[{15, 32}, "Single"]}, {AtomDiagramCoordinates -> CompressedData["

 "O", "O", "O", "C", "C", "C", "C", "C", "C", "B", "H", "H", "H", 
 "H", "H", "H", "H"}, {
Bond[{1, 7}, "Single"], 
Bond[{1, 15}, "Single"], 
Bond[{2, 10}, "Single"], 
Bond[{2, 16}, "Single"], 
Bond[{3, 10}, "Single"], 
Bond[{3, 17}, "Single"], 
Bond[{4, 5}, "Aromatic"], 
Bond[{4, 6}, "Aromatic"], 
Bond[{4, 10}, "Single"], 
Bond[{5, 7}, "Aromatic"], 
Bond[{5, 11}, "Single"], 
Bond[{6, 8}, "Aromatic"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 9}, "Aromatic"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 13}, "Single"], 
Bond[{9, 14}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{17, 3}, {CompressedData["
"], "Angstroms", {{1}, {
 AtomDiagramCoordinates -> {{2., -1.75}, {4.5981, 1.75}, {2.866, 
 1.75}, {3.7321, 0.25}, {2.866, -0.25}, {4.5981, -0.25}, {
 2.866, -1.25}, {4.5981, -1.25}, {3.7321, -1.75}, {3.7321, 
 1.25}, {2.3291, 0.06}, {5.135, 0.06}, {5.135, -1.56}, {
 3.7321, -2.37}, {2., -2.37}, {4.5981, 2.37}, {2.866, 2.37}}}], 
 "O", "O", "O", "N", "C", "C", "C", "C", "C", "C", "B", "H", "H", 
 "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 8}, "Single"], 
Bond[{1, 10}, "Single"], 
Bond[{2, 11}, "Single"], 
Bond[{2, 18}, "Single"], 
Bond[{3, 11}, "Single"], 
Bond[{3, 19}, "Single"], 
Bond[{4, 8}, "Aromatic"], 
Bond[{4, 9}, "Aromatic"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 9}, "Aromatic"], 
Bond[{5, 11}, "Single"], 
Bond[{6, 7}, "Aromatic"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 8}, "Aromatic"], 
Bond[{7, 13}, "Single"], 
Bond[{9, 14}, "Single"], 
Bond[{10, 15}, "Single"], 
Bond[{10, 16}, "Single"], 
Bond[{10, 17}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{19, 3}, {CompressedData["
"], "Angstroms", {{
 1}, {2}}}]], AtomDiagramCoordinates -> CompressedData["
 "F", "F", "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", 
 "C", "C", "C", "C", "C", "C", "C", "B", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 20}, "Single"], 
Bond[{2, 20}, "Single"], 
Bond[{3, 20}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 21}, "Single"], 
Bond[{5, 32}, "Single"], 
Bond[{6, 21}, "Single"], 
Bond[{6, 33}, "Single"], 
Bond[{7, 8}, "Single"], 
Bond[{7, 12}, "Aromatic"], 
Bond[{7, 13}, "Aromatic"], 
Bond[{8, 22}, "Single"], 
Bond[{8, 23}, "Single"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{9, 15}, "Aromatic"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 18}, "Aromatic"], 
Bond[{10, 20}, "Single"], 
Bond[{11, 24}, "Single"], 
Bond[{12, 16}, "Aromatic"], 
Bond[{12, 25}, "Single"], 
Bond[{13, 17}, "Aromatic"], 
Bond[{13, 26}, "Single"], 
Bond[{14, 16}, "Aromatic"], 
Bond[{14, 17}, "Aromatic"], 
Bond[{14, 21}, "Single"], 
Bond[{15, 19}, "Aromatic"], 
Bond[{15, 27}, "Single"], 
Bond[{16, 28}, "Single"], 
Bond[{17, 29}, "Single"], 
Bond[{18, 19}, "Aromatic"], 
Bond[{18, 30}, "Single"], 
Bond[{19, 31}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{33, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 "F", "F", "F", "O", "C", "C", "C", "B", "H", "H", "H", "H", "H", 
 "H", "H", "H"}, {
Bond[{1, 8}, "Single"], 
Bond[{2, 8}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{4, 6}, "Single"], 
Bond[{4, 16}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{5, 7}, "Single"], 
Bond[{5, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{6, 11}, "Single"], 
Bond[{6, 12}, "Single"], 
Bond[{7, 13}, "Single"], 
Bond[{7, 14}, "Single"], 
Bond[{7, 15}, "Single"]}, {
 AtomDiagramCoordinates -> {{2.702, 1.5}, {0.9699, 1.5}, {1.836, 
 0.}, {0.5369, 4.5369}, {2.269, 4.5369}, {1.4030000000000002`, 
 4.0369}, {3.1350000000000002`, 4.0369}, {1.836, 1.}, {2.6675, 
 5.0119}, {1.8705, 5.0119}, {1.0044, 3.562}, {1.8015, 3.562}, {
 2.825, 3.5}, {3.6719, 3.7269}, {3.4450000000000003`, 4.5739}, {
 0., 4.2269}}}], 
 "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
 "C", "C", "C", "C", "B", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H"}, {
Bond[{1, 8}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{3, 18}, "Single"], 
Bond[{3, 29}, "Single"], 
Bond[{4, 18}, "Single"], 
Bond[{4, 30}, "Single"], 
Bond[{5, 6}, "Single"], 
Bond[{5, 8}, "Aromatic"], 
Bond[{5, 9}, "Aromatic"], 
Bond[{6, 19}, "Single"], 
Bond[{6, 20}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 12}, "Aromatic"], 
Bond[{8, 15}, "Aromatic"], 
Bond[{9, 16}, "Aromatic"], 
Bond[{9, 21}, "Single"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 22}, "Single"], 
Bond[{11, 13}, "Aromatic"], 
Bond[{11, 18}, "Single"], 
Bond[{12, 14}, "Aromatic"], 
Bond[{12, 23}, "Single"], 
Bond[{13, 14}, "Aromatic"], 
Bond[{13, 24}, "Single"], 
Bond[{14, 25}, "Single"], 
Bond[{15, 17}, "Aromatic"], 
Bond[{15, 26}, "Single"], 
Bond[{16, 17}, "Aromatic"], 
Bond[{16, 27}, "Single"], 
Bond[{17, 28}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{30, 3}, {CompressedData["
"], "Angstroms", {{1}, {
 2}}}]], AtomDiagramCoordinates -> CompressedData["
 "F", "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "B", 
 "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 8}, "Single"], 
Bond[{2, 9}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 12}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 19}, "Single"], 
Bond[{5, 13}, "Single"], 
Bond[{5, 20}, "Single"], 
Bond[{6, 8}, "Aromatic"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{6, 13}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 11}, "Aromatic"], 
Bond[{8, 10}, "Aromatic"], 
Bond[{9, 11}, "Aromatic"], 
Bond[{10, 14}, "Single"], 
Bond[{11, 15}, "Single"], 
Bond[{12, 16}, "Single"], 
Bond[{12, 17}, "Single"], 
Bond[{12, 18}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{20, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "B", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H"}, {
Bond[{11, 10}, "Single"], 
Bond[{10, 9}, "Double"], 
Bond[{9, 3}, "Single"], 
Bond[{3, 4}, "Single"], 
Bond[{4, 6}, "Single"], 
Bond[{6, 8}, "Single"], 
Bond[{8, 7}, "Single"], 
Bond[{7, 5}, "Single"], 
Bond[{11, 1}, "Single"], 
Bond[{11, 2}, "Single"], 
Bond[{5, 3}, "Single"], 
Bond[{10, 24}, "Single"], 
Bond[{9, 23}, "Single"], 
Bond[{3, 12}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{6, 17}, "Single"], 
Bond[{6, 18}, "Single"], 
Bond[{8, 21}, "Single"], 
Bond[{8, 22}, "Single"], 
Bond[{7, 19}, "Single"], 
Bond[{7, 20}, "Single"], 
Bond[{5, 15}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{1, 25}, "Single"], 
Bond[{2, 26}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{26, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 StereochemistryElements -> {
 "StereoType" -> "DoubleBond", "StereoBond" -> {10, 9}, "Value" -> 
 "Opposite", "Ligands" -> {11, 3}]}}], 
 "Cl", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
 "C", "C", "C", "C", "C", "C", "B", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 19}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 11}, "Single"], 
Bond[{3, 20}, "Single"], 
Bond[{3, 35}, "Single"], 
Bond[{4, 20}, "Single"], 
Bond[{4, 36}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 7}, "Aromatic"], 
Bond[{6, 9}, "Aromatic"], 
Bond[{6, 13}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 14}, "Single"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 10}, "Aromatic"], 
Bond[{8, 20}, "Single"], 
Bond[{9, 21}, "Single"], 
Bond[{10, 22}, "Single"], 
Bond[{11, 12}, "Single"], 
Bond[{11, 23}, "Single"], 
Bond[{11, 24}, "Single"], 
Bond[{12, 15}, "Aromatic"], 
Bond[{12, 16}, "Aromatic"], 
Bond[{13, 25}, "Single"], 
Bond[{13, 26}, "Single"], 
Bond[{13, 27}, "Single"], 
Bond[{14, 28}, "Single"], 
Bond[{14, 29}, "Single"], 
Bond[{14, 30}, "Single"], 
Bond[{15, 17}, "Aromatic"], 
Bond[{15, 31}, "Single"], 
Bond[{16, 18}, "Aromatic"], 
Bond[{16, 32}, "Single"], 
Bond[{17, 19}, "Aromatic"], 
Bond[{17, 33}, "Single"], 
Bond[{18, 19}, "Aromatic"], 
Bond[{18, 34}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{36, 3}, {CompressedData["
 "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 "F", "F", "F", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", 
 "C", "C", "B", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H"}, {
Bond[{1, 10}, "Single"], 
Bond[{2, 12}, "Single"], 
Bond[{3, 14}, "Single"], 
Bond[{4, 7}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{5, 25}, "Single"], 
Bond[{6, 16}, "Single"], 
Bond[{6, 26}, "Single"], 
Bond[{7, 8}, "Single"], 
Bond[{7, 17}, "Single"], 
Bond[{7, 18}, "Single"], 
Bond[{8, 13}, "Single"], 
Bond[{8, 19}, "Single"], 
Bond[{8, 20}, "Single"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{9, 12}, "Aromatic"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{11, 14}, "Aromatic"], 
Bond[{11, 16}, "Single"], 
Bond[{12, 15}, "Aromatic"], 
Bond[{13, 21}, "Single"], 
Bond[{13, 22}, "Single"], 
Bond[{13, 23}, "Single"], 
Bond[{14, 15}, "Aromatic"], 
Bond[{15, 24}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{26, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
 "B", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H"}, {
Bond[{1, 6}, "Single"], 
Bond[{1, 8}, "Single"], 
Bond[{2, 14}, "Single"], 
Bond[{2, 28}, "Single"], 
Bond[{3, 14}, "Single"], 
Bond[{3, 29}, "Single"], 
Bond[{4, 5}, "Single"], 
Bond[{4, 6}, "Single"], 
Bond[{4, 15}, "Single"], 
Bond[{4, 16}, "Single"], 
Bond[{5, 7}, "Single"], 
Bond[{5, 17}, "Single"], 
Bond[{5, 18}, "Single"], 
Bond[{6, 19}, "Single"], 
Bond[{6, 20}, "Single"], 
Bond[{7, 21}, "Single"], 
Bond[{7, 22}, "Single"], 
Bond[{7, 23}, "Single"], 
Bond[{8, 9}, "Aromatic"], 
Bond[{8, 11}, "Aromatic"], 
Bond[{9, 10}, "Aromatic"], 
Bond[{9, 24}, "Single"], 
Bond[{10, 12}, "Aromatic"], 
Bond[{10, 14}, "Single"], 
Bond[{11, 13}, "Aromatic"], 
Bond[{11, 25}, "Single"], 
Bond[{12, 13}, "Aromatic"], 
Bond[{12, 26}, "Single"], 
Bond[{13, 27}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{29, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 "Cl", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "B", 
 "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 11}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 9}, "Single"], 
Bond[{3, 13}, "Single"], 
Bond[{3, 22}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 23}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 7}, "Aromatic"], 
Bond[{6, 8}, "Aromatic"], 
Bond[{6, 13}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 14}, "Single"], 
Bond[{8, 11}, "Aromatic"], 
Bond[{8, 15}, "Single"], 
Bond[{9, 12}, "Single"], 
Bond[{9, 16}, "Single"], 
Bond[{9, 17}, "Single"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 18}, "Single"], 
Bond[{12, 19}, "Single"], 
Bond[{12, 20}, "Single"], 
Bond[{12, 21}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{23, 3}, {CompressedData["
 "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
 "O", "O", "O", "O", "C", "C", "C", "C", "C", "C", "C", "C", "C", 
 "B", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 9}, "Single"], 
Bond[{1, 12}, "Single"], 
Bond[{2, 9}, "Double"], 
Bond[{3, 14}, "Single"], 
Bond[{3, 24}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{4, 25}, "Single"], 
Bond[{5, 6}, "Aromatic"], 
Bond[{5, 7}, "Aromatic"], 
Bond[{5, 9}, "Single"], 
Bond[{6, 8}, "Aromatic"], 
Bond[{6, 14}, "Single"], 
Bond[{7, 10}, "Aromatic"], 
Bond[{7, 15}, "Single"], 
Bond[{8, 11}, "Aromatic"], 
Bond[{8, 16}, "Single"], 
Bond[{10, 11}, "Aromatic"], 
Bond[{10, 17}, "Single"], 
Bond[{11, 18}, "Single"], 
Bond[{12, 13}, "Single"], 
Bond[{12, 19}, "Single"], 
Bond[{12, 20}, "Single"], 
Bond[{13, 21}, "Single"], 
Bond[{13, 22}, "Single"], 
Bond[{13, 23}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{25, 3}, {CompressedData["

"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["


bases= {Molecule[{
Atom["Na", "FormalCharge" -> 1], 
Atom["O", "FormalCharge" -> -1], "H"}, {
Bond[{2, 3}, "Single"]}, {
 AtomDiagramCoordinates -> {{2., 0.25}, {2.866, -0.25}, {3.403, 
 "P", "N", "N", "N", "N", "C", "C", "C", "C", "C", "C", "C", "C", 
 "C", "C", "C", "C", "C", "C", "C", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", "H", 
 "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{1, 3}, "Single"], 
Bond[{1, 4}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 14}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 13}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{5, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{5, 11}, "Single"], 
Bond[{6, 9}, "Single"], 
Bond[{6, 21}, "Single"], 
Bond[{6, 22}, "Single"], 
Bond[{7, 10}, "Single"], 
Bond[{7, 23}, "Single"], 
Bond[{7, 24}, "Single"], 
Bond[{8, 11}, "Single"], 
Bond[{8, 25}, "Single"], 
Bond[{8, 26}, "Single"], 
Bond[{9, 27}, "Single"], 
Bond[{9, 28}, "Single"], 
Bond[{10, 29}, "Single"], 
Bond[{10, 30}, "Single"], 
Bond[{11, 31}, "Single"], 
Bond[{11, 32}, "Single"], 
Bond[{12, 19}, "Single"], 
Bond[{12, 20}, "Single"], 
Bond[{12, 35}, "Single"], 
Bond[{13, 15}, "Single"], 
Bond[{13, 18}, "Single"], 
Bond[{13, 34}, "Single"], 
Bond[{14, 16}, "Single"], 
Bond[{14, 17}, "Single"], 
Bond[{14, 33}, "Single"], 
Bond[{15, 48}, "Single"], 
Bond[{15, 49}, "Single"], 
Bond[{15, 50}, "Single"], 
Bond[{16, 45}, "Single"], 
Bond[{16, 46}, "Single"], 
Bond[{16, 47}, "Single"], 
Bond[{17, 42}, "Single"], 
Bond[{17, 43}, "Single"], 
Bond[{17, 44}, "Single"], 
Bond[{18, 39}, "Single"], 
Bond[{18, 40}, "Single"], 
Bond[{18, 41}, "Single"], 
Bond[{19, 36}, "Single"], 
Bond[{19, 37}, "Single"], 
Bond[{19, 38}, "Single"], 
Bond[{20, 51}, "Single"], 
Bond[{20, 52}, "Single"], 
Bond[{20, 53}, "Single"]}, {AtomCoordinates -> QuantityArray[
StructuredArray`StructuredData[{53, 3}, {CompressedData["
"], "Angstroms", {{1}, {2}}}]], 
 AtomDiagramCoordinates -> CompressedData["
"]}], Molecule[{
Atom["C", "FormalCharge" -> -1], "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{1, 4}, "Single"], 
Bond[{1, 5}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{2, 8}, "Single"]}, {
 AtomDiagramCoordinates -> {{2.866, 0.}, {3.7321, 0.5}, {
 2., -0.5}, {2.556, 0.5369}, {3.176, -0.5369}, {
 4.0421, -0.0369}, {4.269, 0.81}, {3.4221, 1.0369}}}], 
Atom["C", "FormalCharge" -> -1], "C", "C", "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H", "H", "H", 
 "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{1, 3}, "Single"], 
Bond[{1, 6}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{2, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{3, 10}, "Single"], 
Bond[{3, 11}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{4, 13}, "Single"], 
Bond[{4, 14}, "Single"]}, {
 AtomDiagramCoordinates -> {{2.866, -0.25}, {2.866, 0.75}, {
 3.7321, -0.75}, {2., 1.25}, {2.866, -1.25}, {3.403, 0.06}, {
 3.4766, 0.6423000000000001}, {3.0781, 1.3326}, {
 3.4221, -1.2869}, {4.269, -1.06}, {
 4.0421, -0.21310000000000004`}, {2.31, 1.7869}, {1.4631, 
 1.56}, {1.69, 0.7131000000000001}}}], Molecule[{
Atom["K", "FormalCharge" -> 1], 
Atom["O", "FormalCharge" -> -1], "H"}, {
Bond[{2, 3}, "Single"]}, {
 AtomDiagramCoordinates -> {{2., 0.25}, {2.866, -0.25}, {3.403, 
 0.06}}}], Molecule[{
Atom["O", "FormalCharge" -> -1], "C", "C", "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{4, 10}, "Single"], 
Bond[{4, 11}, "Single"], 
Bond[{4, 12}, "Single"]}, {
 AtomDiagramCoordinates -> {{3.7321, 0.75}, {2.866, 0.25}, {2., 
 0.75}, {2.866, -0.75}, {4.5981, 0.25}, {2.866, 0.87}, {2.31, 
 1.2869}, {1.4631, 1.06}, {1.69, 0.21310000000000004`}, {
 2.246, -0.75}, {2.866, -1.37}, {3.486, -0.75}}}], 
 Molecule[{"Ba", "O", "O", "O", 
Atom["C", "MassNumber" -> 13], "H", "H"}, {
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{4, 5}, "Double"]}, {
 AtomDiagramCoordinates -> {{1.153, 3.5}, {2.269, 1.5}, {0.5369, 
 1.5}, {1.4030000000000002`, 0.}, {1.4030000000000002`, 1.}, {
 2.8059, 1.19}, {0., 1.19}}}], Molecule[{
Atom["O", "FormalCharge" -> -1], 
Atom["N", "FormalCharge" -> 1], "C", "C", "C", "C", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 19}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{4, 10}, "Single"], 
Bond[{4, 11}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{5, 13}, "Single"], 
Bond[{5, 14}, "Single"], 
Bond[{5, 15}, "Single"], 
Bond[{6, 16}, "Single"], 
Bond[{6, 17}, "Single"], 
Bond[{6, 18}, "Single"]}, {AtomDiagramCoordinates -> CompressedData["
"]}], Molecule[{
Atom["O", "FormalCharge" -> -1], "O", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H"}, {
Bond[{1, 4}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"]}, {
 AtomDiagramCoordinates -> {{0.866, 2.5}, {0.7015000000000001, 
 0.}, {0., 3.}, {1.4030000000000002`, 2.81}, {1.2384, 0.31}, {
 0.1645, 0.31}}}], Molecule[{
Atom["Rb", "FormalCharge" -> 1], 
Atom["O", "FormalCharge" -> -1], "O", "H", "H", "H"}, {
Bond[{2, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"]}, {
 AtomDiagramCoordinates -> {{0., 0.5}, {0.866, 0.}, {
 0.7015000000000001, 2.5}, {1.4030000000000002`, 0.31}, {1.2384, 
 2.81}, {0.1645, 2.81}}}], Molecule[{
Atom["O", "FormalCharge" -> -1], 
Atom["N", "FormalCharge" -> 1], "H", "H", "H", "H", "H"}, {
Bond[{1, 7}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"]}, {
 AtomDiagramCoordinates -> {{0.0369, 3.0739}, {0.5369, 0.5369}, {
 1.0739, 0.8469}, {0., 0.2269}, {0.2269, 1.0739}, {0.8469, 0.}, {
 1.0369, 3.0739}}}], Molecule[{
Atom["K", "FormalCharge" -> 1], 
Atom["O", "FormalCharge" -> -1], "C", "C", "C", "C", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H"}, {
Bond[{2, 4}, "Single"], 
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{5, 11}, "Single"], 
Bond[{5, 12}, "Single"], 
Bond[{6, 13}, "Single"], 
Bond[{6, 14}, "Single"], 
Bond[{6, 15}, "Single"]}, {
 AtomDiagramCoordinates -> {{5.4641, 0.75}, {4.5981, 0.25}, {2.866,
 0.25}, {3.7321, 0.75}, {2., 0.75}, {2.866, -0.75}, {2.866, 
 0.87}, {4.1306, 1.225}, {3.3335, 1.225}, {2.31, 1.2869}, {
 1.4631, 1.06}, {1.69, 0.21310000000000004`}, {2.246, -0.75}, {
 2.866, -1.37}, {3.486, -0.75}}}], Molecule[{
Atom["O", "FormalCharge" -> -1], "C", "C", "C", "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H", "H", "H", 
 "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{2, 3}, "Single"], 
Bond[{2, 4}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{4, 10}, "Single"], 
Bond[{4, 11}, "Single"], 
Bond[{4, 12}, "Single"], 
Bond[{5, 13}, "Single"], 
Bond[{5, 14}, "Single"], 
Bond[{5, 15}, "Single"]}, {
 AtomDiagramCoordinates -> {{3.7321, 0.5}, {2.866, 0.}, {
 2., -0.5}, {2.366, 0.866}, {3.366, -0.866}, {4.5981, 0.}, {1.69,
 0.0369}, {1.4631, -0.81}, {2.31, -1.0369}, {2.903, 1.176}, {
 2.056, 1.4030000000000002`}, {1.8291, 0.556}, {
 2.8291, -1.176}, {3.676, -1.4030000000000002`}, {
 3.903, -0.556}}}], Molecule[{
Atom["Cl", "FormalCharge" -> -1], 
Atom["Mg", "FormalCharge" -> 2], 
Atom["C", "FormalCharge" -> -1], "C", "C", "C", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H"}, {
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"], 
Bond[{4, 7}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{5, 11}, "Single"], 
Bond[{5, 12}, "Single"], 
Bond[{6, 13}, "Single"], 
Bond[{6, 14}, "Single"], 
Bond[{6, 15}, "Single"]}, {
 AtomDiagramCoordinates -> {{4.5981, 0.}, {3.7321, 0.5}, {2.866, 
 0.}, {2., -0.5}, {2.366, 0.866}, {3.366, -0.866}, {1.69, 
 0.0369}, {1.4631, -0.81}, {2.31, -1.0369}, {2.903, 1.176}, {
 2.056, 1.4030000000000002`}, {1.8291, 0.556}, {
 2.8291, -1.176}, {3.676, -1.4030000000000002`}, {
 3.903, -0.556}}}], Molecule[{
Atom["Br", "FormalCharge" -> -1], 
Atom["Mg", "FormalCharge" -> 2], 
Atom["C", "FormalCharge" -> -1], "C", "H", "H", "H", "H", "H"}, {
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"], 
Bond[{4, 7}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"]}, {
 AtomDiagramCoordinates -> {{2., 1.25}, {2.866, 0.75}, {
 2.866, -0.25}, {2.866, -1.25}, {3.403, -0.56}, {3.403, 0.06}, {
 2.246, -1.25}, {2.866, -1.87}, {3.486, -1.25}}}], Molecule[{
Atom["N", "FormalCharge" -> -1], "C", "C", 
Atom["Li", "FormalCharge" -> 1], "H", "H", "H", "H", "H", "H"}, {
Bond[{1, 2}, "Single"], 
Bond[{1, 3}, "Single"], 
Bond[{2, 5}, "Single"], 
Bond[{2, 6}, "Single"], 
Bond[{2, 7}, "Single"], 
Bond[{3, 8}, "Single"], 
Bond[{3, 9}, "Single"], 
Bond[{3, 10}, "Single"]}, {
 AtomDiagramCoordinates -> {{2.866, 0.25}, {3.7321, 0.75}, {
 2.866, -0.75}, {2., 0.75}, {4.0421, 0.21310000000000004`}, {
 4.269, 1.06}, {3.4221, 1.2869}, {2.246, -0.75}, {
 2.866, -1.37}, {3.486, -0.75}}}], Molecule[{
Atom["Ca", "FormalCharge" -> 2], 
Atom["O", "FormalCharge" -> -1], 
Atom["O", "FormalCharge" -> -1], "O", "C"}, {
Bond[{2, 5}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{4, 5}, "Double"]}, {
 AtomDiagramCoordinates -> {{0.8536, 2.}, {0.8536, 3.}, {-0.1464, 
 2.}, {-0.8536, 3.7071}, {-0.1464, 3.}}}], 
 Molecule[{"Ni", "Ni", 
Atom["Ni", "FormalCharge" -> 2], "O", "O", "O", "O", 
Atom["O", "FormalCharge" -> -1], 
Atom["O", "FormalCharge" -> -1], "O", "O", "C", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H"}, {
Bond[{4, 13}, "Single"], 
Bond[{4, 14}, "Single"], 
Bond[{5, 15}, "Single"], 
Bond[{5, 16}, "Single"], 
Bond[{6, 17}, "Single"], 
Bond[{6, 18}, "Single"], 
Bond[{7, 19}, "Single"], 
Bond[{7, 20}, "Single"], 
Bond[{8, 12}, "Single"], 
Bond[{9, 12}, "Single"], 
Bond[{10, 12}, "Double"], 
Bond[{11, 21}, "Single"], 
Bond[{11, 22}, "Single"]}, {AtomDiagramCoordinates -> CompressedData["

"]}], Molecule[{
Atom["Cl", "FormalCharge" -> -1], 
Atom["Mg", "FormalCharge" -> 2], "C", 
Atom["C", "FormalCharge" -> -1], "C", "C", "C", "H", "H", "H", "H", 
 "H", "H", "H", "H", "H", "H", "H"}, {
Bond[{3, 4}, "Single"], 
Bond[{3, 5}, "Single"], 
Bond[{3, 6}, "Single"], 
Bond[{3, 7}, "Single"], 
Bond[{4, 8}, "Single"], 
Bond[{4, 9}, "Single"], 
Bond[{5, 10}, "Single"], 
Bond[{5, 11}, "Single"], 
Bond[{5, 12}, "Single"], 
Bond[{6, 13}, "Single"], 
Bond[{6, 14}, "Single"], 
Bond[{6, 15}, "Single"], 
Bond[{7, 16}, "Single"], 
Bond[{7, 17}, "Single"], 
Bond[{7, 18}, "Single"]}, {
 AtomDiagramCoordinates -> {{2., -0.4145}, {
 2.866, -0.9145000000000001}, {4.5981, 0.0855}, {
 3.7321, -0.4145}, {5.4641, 0.5855}, {
 5.0981, -0.7806000000000001}, {4.0981, 0.9515000000000001}, {
 3.4221, 0.12240000000000001`}, {4.0421, -0.9515000000000001}, {
 5.7741, 0.04850000000000001}, {6.001, 0.8955}, {5.1541, 
 1.1224}, {4.5611, -1.0906}, {
 5.408100000000001, -1.3175000000000001`}, {5.635, -0.4706}, {
 4.635, 1.2615}, {3.7881, 1.4884000000000002`}, {3.5611, 

FeatureSpacePlot now has a built-in feature extractor for molecules:


 Join[Thread[Style[acids, RGBColor[0.8, 0.2, 0.19215686274509805`]]], 
 Style[bases, RGBColor[
 0.2901960784313726, 0.4392156862745098, 0.8901960784313725]]]]]

Chemical Formulas & Chemical Reactions (December 2021)

In Version 12 we introduced Molecule as a symbolic representation of a molecule in chemistry. In successive versions weve steadily been adding more capabilities around Molecule. In Version 13.0 were adding things like the capability to annotate 2D and 3D molecule plots with additional information:



Molecule provides a representation for a specific type of molecule, with a specific arrangement of atoms in 3D space. In Version 13.0, however, were generalizing to arbitrary chemical formulas, in which one describes the number of each type of atom, without giving information on bonds or 3D arrangement. One can enter a chemical formula just as a string:


From the formula alone its possible to compute a few properties, like molecular mass:


Given the chemical formula, one can ask for specific known molecules that have that formula:


Often there will be many such molecules, and for example one could see how theyre arranged in chemical feature space:


Now that we can handle both molecules and chemical formulas, the next big step is chemical reactions. And in Version 13.0 the beginning of that is the ability to represent a chemical reaction symbolically.

You can enter a reaction as a string:


Heres the reaction represented in terms of explicit rules:


But this is not yet a balanced reaction. To balance it, we can use ReactionBalance:


And, needless to say, ReactionBalance is quite general, so it can deal with reactions whose balancing requires solving slightly nontrivial Diophantine equations:


Biomolecular Sequences: Symbolic DNA, Proteins, etc. (December 2020)

There are so many different things in so many areas in Version 12.2 that its hard to know where to start. But lets talk about a completely new area: bio-sequence computation. Yes, weve had gene and protein data in the Wolfram Language for more than a decade. But whats new in 12.2 is the beginning of the ability to do flexible, general computation with bio sequences. And to do it in a way that fits in with all the chemical computation capabilities weve been adding to the Wolfram Language over the past few years.

Heres how we represent a DNA sequence (and, yes, this works with very long sequences too):



This translates the sequence to a peptide (like a symbolic ribosome):



Now we can find out what the corresponding molecule is:



And visualize it in 3D (or compute lots of properties):



I have to say that I agonized a bit about the non-universality of putting the specifics of our biology into our core language… but it definitely swayed my thinking that, of course, all our users are (for now) definitively eukaryotes. Needless to say, though, were set up to deal with other branches of life too:



You might think that handling genome sequences is just string manipulation—and indeed our string functions are now set up to work with bio sequences:


StringReverse[BioSequence["DNA", "CTTTTCGAGATCTCGGCGTCA"]]

But theres also a lot of biology-specific additional functionality. Like this finds a complementary base-pair sequence:


BioSequenceComplement[BioSequence["DNA", "CTTTTCGAGATCTCGGCGTCA"]]

Actual, experimental sequences often have base pairs that are somehow uncertain—and there are standard conventions for representing this (e.g. S means C or G; N means any base). And now our string patterns also understand things like this for bio sequences:


StringMatchQ[BioSequence["DNA", "CTTT"], "STTT"]

And there are new functions like BioSequenceInstances for resolving degenerate characters:


BioSequenceInstances[BioSequence["DNA", "STTT"]]

BioSequence is also completely integrated with our built-in genome and protein data. Heres a gene that we can ask for in natural language Wolfram|Alpha style:



Now we ask to do sequence alignment between these two genes (in this case, both human—which is, needless to say, the default):


DynamicModuleBox[{Typeset`query$$= "hba1 gene", Typeset`boxes$$= 
 TemplateBox[{"\"hemoglobin, alpha 1\"", 
RowBox[{"Entity", "[", 
RowBox[{"\"Gene\"", ",", 
RowBox[{"\"HBA1\"", ",", 
RowBox[{"\"Species\"", "->", "\"HomoSapiens\""}], "}"}]}], "}"}]}], 
 "\"Entity[\\\"Gene\\\", {\\\"HBA1\\\", {\\\"Species\\\" -> \\\
\"HomoSapiens\\\"}}]\"", "\"gene\""}, "Entity"], 
 Typeset`allassumptions$$= {{
 "type" -> "SubCategory", "word" -> "hba1 gene", "template" -> 
 "Assuming ${desc1}. Use ${desc2} instead", "count" -> "5", 
 "Values" -> {{
 "name" -> "{HBA1, {Species -> HomoSapiens}}", "desc" -> 
 "HBA1 (human gene)", "input" -> 
, {"name" -> "{HbaA1, {Species -> MusMusculus}}", "desc" -> 
 "Hba-a1 (mouse gene)", "input" -> 
"}, {"name" -> "{HbaA2, {Species -> RattusNorvegicus}}", "desc" -> 
 "Hba-a2 (rat gene)", "input" -> 
RattusNorvegicus---"}, {
 "name" -> "{HBA1, {Species -> PanTroglodytes}}", "desc" -> 
 "HBA1 (chimpanzee gene)", "input" -> 
-"}, {"name" -> "{HBA1, {Species -> GallusGallus}}", "desc" -> 
 "HBA1 (chicken gene)", "input" -> 
"}}}}, Typeset`assumptions$$= {}, Typeset`open$$= {1, 2}, 
 Typeset`querystate$$= {
 "Online" -> True, "Allowed" -> True, "mparse.jsp" -> 
 0.773582`6.3400513493594115, "Messages" -> {}}}, 
AlphaIntegration`LinguisticAssistantBoxes["", 4, Automatic, 
Dynamic[Typeset`querystate$$]], StandardForm],
ImageSizeCache->{223., {7., 15.}},
 Typeset`query$$, Typeset`boxes$$, Typeset`allassumptions$$, 
 Typeset`assumptions$$, Typeset`open$$, Typeset`querystate$$}],
SelectWithContents->True]\)], BioSequence[\!\(\*
DynamicModuleBox[{Typeset`query$$= "hba2 gene", Typeset`boxes$$= 
 TemplateBox[{"\"hemoglobin, alpha 2\"", 
RowBox[{"Entity", "[", 
RowBox[{"\"Gene\"", ",", 
RowBox[{"\"HBA2\"", ",", 
RowBox[{"\"Species\"", "->", "\"HomoSapiens\""}], "}"}]}], "}"}]}], 
 "\"Entity[\\\"Gene\\\", {\\\"HBA2\\\", {\\\"Species\\\" -> \\\
\"HomoSapiens\\\"}}]\"", "\"gene\""}, "Entity"], 
 Typeset`allassumptions$$= {{
 "type" -> "SubCategory", "word" -> "hba2 gene", "template" -> 
 "Assuming ${desc1}. Use ${desc2} instead", "count" -> "5", 
 "Values" -> {{
 "name" -> "{HBA2, {Species -> HomoSapiens}}", "desc" -> 
 "HBA2 (human gene)", "input" -> 
, {"name" -> "{HBA, {Species -> BosTaurus}}", "desc" -> 
 "HBA (cow gene)", "input" -> 
 "*DPClash.GeneE.hba2+gene-_**HBA.*Species_BosTaurus---"}, {
 "name" -> "{Hbae1, {Species -> DanioRerio}}", "desc" -> 
 "hbae1 (zebrafish gene)", "input" -> 
, {"name" -> "{HBA2, {Species -> PanTroglodytes}}", "desc" -> 
 "HBA2 (chimpanzee gene)", "input" -> 
-"}, {"name" -> "{HBA2, {Species -> GallusGallus}}", "desc" -> 
 "HBA2 (chicken gene)", "input" -> 
"}}}}, Typeset`assumptions$$= {}, Typeset`open$$= {1, 2}, 
 Typeset`querystate$$= {
 "Online" -> True, "Allowed" -> True, "mparse.jsp" -> 
 0.754947`6.3294614571576355, "Messages" -> {}}}, 
AlphaIntegration`LinguisticAssistantBoxes["", 4, Automatic, 
Dynamic[Typeset`querystate$$]], StandardForm],
ImageSizeCache->{223., {7., 15.}},
 Typeset`query$$, Typeset`boxes$$, Typeset`allassumptions$$, 
 Typeset`assumptions$$, Typeset`open$$, Typeset`querystate$$}],

Whats in 12.2 is really just the beginning of what were planning for bio-sequence computation. But already you can do very flexible things with large datasets. And, for example, its now straightforward for me to read my genome in from FASTA files and start exploring it…



Bio Sequences: Plots, Secondary Bonds and More (December 2021)

In Version 12.2 we introduced the concept of BioSequence, to represent molecules like DNA, RNA and proteins that consist of sequences of discrete units. In Version 13.0 were adding a variety of new BioSequence capabilities. One is BioSequencePlot, which provides an immediate visual representation of bio sequences:


But beyond visualization, Version 13.0 also adds the ability to represent secondary structure in RNA, proteins and single-stranded DNA. Here, for example, is a piece of RNA with additional hydrogen bonds:


You can also specify secondary structure using dot-bracket notation:


BioSequence also supports hybrid strands, involving for example linking between DNA and RNA:


Molecule converts BioSequence to an explicit collection of atoms:


Putting it all together, heres an example of crosslinking between two peptides (now with disulfide bonds), in this case for insulin:



7. Liberal Arts, Meet Computation A Wolfram Community Introduction, 20 [-/+]
(?)  (?)
We can guess if youre reading the Wolfram Blog that youre probably a Wolfram Language user, whether as a recreational programmer, a physics professor or a high-powered data scientist. And lets be honest about another thing: if youre using it to solve algebraic integrals or analyze SARS-CoV-2 genetic sequences or some other complex subject, youre likely a big-brained person. I mean, youre investigating the very nature of the universe in all its facets, right? So whats the problem? Well, there isnt oneexcept maybe all those people (well-meaning friends, family members or even colleagues)who have no understanding of what you do. In their minds, its all just a big combination of ones and zeros with no place for the good, the true or the beautiful. Wheres the art? they say. Wheres the music? The poetry? How come your fancy-pants computational language cant do anything with that? And they could very well be right except for one critical factor: theyre not. If youre talking with a liberal arts majoror worse, an angry mob of them, with metaphorical torches and pitchforksyou can find common ground: by using the very foundations of classical learning contained in the trivium and the quadrivium. You might think Im wrong but Im not. The proof is in the evidence, so lets take a close look at some Wolfram Community posts that exemplify classical liberal arts subjects. The Trivium The idea of the triviumgrammar, logic and rhetoricdates back to Platos dialogues, but the term itself was not used until the eighth-century Carolingian Renaissance. (And for someone like my dad, who wrote his dissertation about a seventeenth-century Andrew Marvell poem, its pretty much the be-all and end-all of higher education.) Wolfram Community has posts, however, that directly relate to all three subject areas. Grammar: A Wolfram Language Facsimile of Wordle  (0)

8. Building a Pulse-Forming Network with the Wolfram Language, 07 [-/+]
(?)  (?)

Building a Pulse-Forming Network with the Wolfram Language

In many physics experiments, a voltage or current is desired that quickly rises to a particular value, stays there for a duration of time and then declines rapidly, giving the so-called flat-top profile or square wave.


RP Photonics Consulting AG, 2022. All rights reserved.

This has multiple applications in many physics- and electrical engineeringrelated systems, including radar, kicker magnets for accelerators and really any time a pulsed uniform voltage or current is needed. In my case, I needed this capability for a metal vapor vacuum arc plasma source that Im using to study the properties of metallic plasmas in strong magnetic fields.

In this blog post, Ill walk you through some pulse-forming network theory along with how I used the Wolfram Language to quickly and easily design a cost-effective pulse-forming network by using circuit theory, the interactive Manipulate function and data from an electronics vendor to explore practical design options. This will also show off the Quantity function in the Wolfram Language, which has proven helpful and easy to use.

Capacitors Discharging

When people consider pulsed-power applications, the natural and easy solution that comes to mind is to connect a capacitor in series with the load, charge it and then discharge it. Assuming the capacitors inductance and series resistance are low, a large current can be created, but that current will rapidly (and exponentially) decay.

Current decay

What do we do to flatten the peak? Increasing the resistance or capacitance will stretch the previous figure horizontally or vertically, but varying the resistance or capacitance will not alter the shape of the discharge curve.

It is worth pointing out that there is one (conceptually) simple solution here: to use a very, very large capacitor. This capacitor will discharge only a minor fraction of its stored energy over the desired pulse width and use a switch to disconnect the circuit after the desired duration.

What about Using a Switch?

While this indeed would produce a very flat profile, it requires capacitances so large that only electrolytic double-layer capacitors (also called supercapacitors) would work. Supercapacitors often have maximum voltages of around 2.7 V, requiring a large number of them in series to get up to a larger voltage. Placing capacitors in series adds the respective equivalent series resistance (ESR) of each capacitor as well as their inductances, often severely limiting the peak current.

Semiconductor switches are also limited in their ability to stop flowing currents, although top-of-the-line transistors, like the IXTN660N04T4 (~$21), can switch around 700 A at approximately 40 V. That may work for some applications like an electromagnet system that requires modest voltages but high currents, but for most applications, this will be prohibitively expensive and still have poor performance.

The RLC Circuit

Getting back to the question How do we flatten the peak of a capacitors discharge curve?, the answer is simply to use inductors. Many inductors are merely wound coils of wire, and inductors tend to resist the change in current through them. They do this by storing the electrical energy in the form of a magnetic field. This is commonly compared to a capacitor, which stores electrical energy in an electrical field.

One of the most famous and important circuits of all time is the resistorinductorcapacitor (RLC) circuit. If the resistance, inductance and capacitance are tuned properly, you can get resonant behavior in which the capacitor and inductor are alternately charging and discharging.

Wolfram|Alpha has some powerful functionality that simulates an RLC circuit and computes its properties:

Wolfram|Alpha RLC circuit properties

Fourier Series

This sinusoidal charge-discharge curve is really important and very useful to what we are building up to. In mathematics, you may have heard of a Fourier series, the idea behind which is that any harmonic function can be closely approximated by a series of superimposed sinusoidal functions.

The pulse shape we are trying to generate is a square wave, and therefore we can use the Fourier series deconstruction of a square wave (or at least the first N terms) to determine a number of RLC circuits in series that approximate a square wave when discharged:

RLC circuits approximate a square wave

The Faults in Our Fourier Series

One important note is that using the Fourier series approximation to produce a perfect square wave has one serious downside: the Gibbs phenomenon, which more or less says that the edges of the approximation will have significant overshoot, and adding more terms does not improve this issue. Some bright physicist determined that looking at the Fourier series of a trapezoidal rather than a square wave suitably solved these issues.

Finally! Pulse-Forming Networks

All right, so thats probably enough theory. To recap, simply discharging a capacitor into a resistive load will give us a sharp rise with exponential decay, and adding an inductor will turn that discharge curve into a sinusoidal shape. Superimposing multiple sinusoidal discharges can create a pretty good approximation to an ideal square discharge curve.

How should we arrange these capacitors and inductors? As it turns out, there are a lot of different forms of pulse-forming networks, usually known by a letter. Many of these have a particular advantage; for example, the type D pulse-forming network uses capacitors of identical capacitance:

Five types of pulse-forming networks

McGraw Hill, 1948. All rights reserved.


Given these variations, youll have to consider your application in great detail to decide which one is best, and that usually comes down to a decision of practicality (i.e. cost and ease of construction).

Practicalities of Building a Pulse-Forming Network

Depending on the voltage, current, rise time and pulse-width requirements of a particular application, difficulties can be found in a number of places. For fast rise times, the issue may be switching (a topic outside the scope of this blog), or even the inductance of the capacitors. For high-voltage applications involving high charge transfer, finding suitable capacitors may be very difficult and expensive. It really depends on the application as well as available capacitor and switching technology. One last note: for most practical purposes, there are few benefits to using more than five sections.

Designing a Particular Pulse-Forming Network

For the remainder of the post, well talk about pulse-forming networks in the context of a particular project: an upgrade I am making to a metal vapor vacuum arc plasma source I built to study various aspects of metal plasmas.

For this application, the switching is performed by the initiation of a vacuum arc by a Marx generatorif youd like an article about Marx generators, mention it in the commentsso switching is not an issue. The main design considerations would be that there should be as fast a rise time as possible; that the current should exceed 100 A throughout the pulse; and that the homogeneity should be reasonably high. The voltage is modestno more than 800 Vand many film capacitors exist that can satiate the desired low ESR and equivalent series inductance (ESL) requirements.

The major design difficulty will be the proper arrangement and choice of capacitors and inductors (necessarily a tradeoff between complexity, cost and performance), and the major implementation difficulty will be in making the inductors. Commercially available inductors that can handle the expected peak currentspossibly in excess of a kiloampereare prohibitively expensive, but making a large coil of thick wire will produce an inductor with high-peak current-handling capabilities on a budget, so long as the needed inductance is low. The desired rise time for this application is less than 500 ns and the pulse width, counted as the period where the current exceeds 100 A, is desired to be around 500 ms.

One final caveat: a little while ago, I picked up two giant power film capacitors in an auction. They are individually able to deliver a surge current of over 20,000 A, and for cost reasons, Id like to use them rather than get all-new capacitors.

Giant power film capacitor

A Note about DIY Pulse-Forming Networks

As far as I am aware, there is only one report on the internet of someone making a DIY pulse-forming network to construct an amateur radar assembly.

While the application considered here is not too complex, there are many circumstances, including very fast rise times, large charge transfer and high voltages, that make professional pulse-forming network design challenging. That being said, theres no reason why they are any more difficult to build than various other resonant circuits.

A word of caution: any of the things discussed here could be potentially dangerous if mishandled, so dont play around with high voltage. The voltages discussed here are potentially lethal and should only be handled by competent, cautious and safety-aware people.

The Type B Pulse-Forming Network

When considering the aforementioned requirements, the natural first choice is the type B pulse-forming network. It is typically the choice when you dont want/need mutual inductance between the various inductors, and it has the neat feature of having two capacitors (the leftmost ones) that have reasonably similar capacitances, where my two 250 F capacitors could go:

Type B pulse-forming network

McGraw Hill, 1948. All rights reserved.


This is where the first difficulty is encountered: capacitors are typically rated at a particular granular capacitance: 250 F, for example, not 263 F. There are capacitors that have odd capacitances, but they are sufficiently unusual that we have to design around the available capacitances:

Sorting capacitors by capacitance

This diagram shows the ideal ratios of the capacitors, and right off the bat it doesnt look to be too bad of a fit. The middle capacitor would need to be 300 F, followed by 350 F and 800 F, respectively, but its not that off. If you wanted to get really precise values, you could use multiple capacitors in parallel to form an equivalent capacitor of some fractionally higher value, but for this project youll soon see why that introduces unreasonable complexity and cost.

So how would this circuit perform? When using the previous diagram along with known load parameters, you get this circuit I simulated using Falstad:

Simulated circuit

When charged and discharged, it produces the following discharge pattern:

Discharge pattern

While there is good homogeneity, there are four downsides to this arrangement:

  1. The rise time is too slow, on the order of several thousand nanoseconds.
  2. The complexity is high, involving five large capacitors and five custom inductors.
  3. The increase in stored energy over the old system (straight discharge of the 2 × 250 µF capacitors into load) is only about four times as much.
  4. The cost is high for what it’s accomplishing, around $200 just for the capacitors (before tax and shipping).

Rethinking the Configuration, Computationally

Now we can get into the real meat of this blog: an interesting electrical engineering problem that is both theoretical and practical. Can the Wolfram Language help us make a cost-effective decision?

To do this, lets get some real-world data about the price and capability of existing capacitors. Then we can create a circuit simulator for these pulse-forming networks to give us some key information about the performance, cost and complexity of a circuit. Then we can have it simulate all possible circuits (within reason) and give us the top-ranked ones.

Easier said than done, but its a nice computational approach and might give us an unexpected result. It would be too tedious to go through and try to figure this out manually, but it will likely take a modern processor seconds or minutes to step through all the permutations.

Getting Data about Capacitors

Ive found that the online electronics distributor Digi-Key has some of the best search tools, and they allow you to download large tables of data about their products. I went to their page on film capacitors and filtered out those with a maximum working voltage under 800 V, as well as capacitors with a capacitance under 500 F. I then downloaded a CSV file of the remaining 151 capacitors.

Importing and Cleaning the Capacitor Data

One of the best but rarely mentioned aspects of the Wolfram Language is that its great for scraping and homogenizing data. Thatll be handy as we import the raw capacitor data and clean it up:


Here are the fields and the first capacitor:


Lets first filter out capacitors that arent in stock or require more than a four-minimum order quantity:



Only 46 capacitors are left. What about price? If a capacitor is too expensive, we shouldnt consider it:

Capacitor cost histogram

Lets consider capacitors with a price below $125 because we will probably need two or three of them:



As a final step to pare down the list of capacitors, lets allow only one capacitor per capacitance class. The ESR of all of these options is quite low, so its not an important factor:



Finally, lets get rid of the data we dont really care about and get our final dataset:



An interesting way to visualize the cost effectiveness of these capacitors is to examine their capacitance per dollar. In this respect, one capacitor in particular has a large advantage: the B25690A0128K903 offers 1200 F for only $60.76:

Capacitor cost versus capacitance chart

Pulse-Forming Network Configuration

In order to optimize for complexity and cost, were going to consider a two-section type B pulse-forming network, with one caveat: to get very fast rise times, the two 250 F capacitors will be attached in series with the load along with a current-limiting resistor. The circuit diagram looks like this:

Circuit diagram

The load is on the left, connected via a current-limiting resistor (500 MOhms) to the two 250 F capacitors I already have. On the right is the behemoth 1200 F capacitor (that we established as the most cost effective), along with a 130 MOhm current-limiting resistor and 250 µH inductor, which shapes the rise of the pulse. When discharged, this circuit produces the following output over one millisecond:

Current rise over one millisecond

Is this a square wave? Not really, but it keeps the current at a single value (510 A) +/ 2.5% for one millisecond; take a look at the current rise:

Current rise output

The current rises to the central value in under 180 ns. And this configuration costs all of $61… I think we have a winner.

Making a Custom Pulse Inductor

The last thing well need to do is design a custom inductor. The design we figured out calls for a 250 µH inductor, and wed like it to be able to handle some very serious current (1 kA+) for 30 ms, in order to have some safety margin. Looking at an American wire gauge (AWG) chart, we can see that any thick copper wire above 8 gauge will do:

Wire gauge chart

I have some short spare lengths of #0 AWG wire, so thats what Ill be using to make this custom pulse inductor.

At its core, an inductor is most commonly a coil of wire. There are publicly available formulas to calculate the inductance of a coil of wire, and we can use them to figure out how to make a 250 µH inductor. Wolfram|Alpha has a feature that allows you to calculate the inductance of a coil of wire:

Wolfram|Alpha RLC circuit properties

After some playing with it, we can get the parameters needed for a coil to supply the required inductance. The end result looks like this:

Wire coil

Begin Your Own Computational Journey

I hope you enjoyed this post. And as for my experiment to study the properties of metallic plasmas in strong magnetic fields that required a pulse-forming network? The results were primarily visual spectra of the metallic plasmas and measurements of their helical paths, which can have unusual instabilities and self-defocusing due to collisions. The pulse-forming network produced a reasonably homogeneous stream of plasma flow that reduced noise and uncertainty in the experiment.

I think pulse-forming network design is interesting because of the union of mathematical theory, physics and electrical engineering. The computational approach to finding optimal electrical components is powerful, and Ive used it often in other scientific projects.

For those who are interested, here are links to two helpful sites I used for this project:

  • Falstada great (free) circuit simulation tool
  • Digi-Keyan electronics components distributor with great component data
Visit Wolfram Community or the Wolfram Function Repository to embark on your own computational adventures!

9. New in 13: Trees, 22 [-/+]
(?)  (?)

Two years ago we released Version 12.0 of the Wolfram Language. Here are the updates in trees since then, including the latest features in 13.0. The contents of this post are compiled from Stephen Wolfram’s Release Announcements for 12.1, 12.2, 12.3 and 13.0.

Trees! (May 2021)

Based on the number of new built-in functions the clear winner for the largest new framework in Version 12.3 is the one for trees. Weve been able to handle trees as a special case of graphs for more than a decade (and of course all symbolic expressions in the Wolfram Language are ultimately represented as trees). But in Version 12.3 were introducing trees as first-class objects in the system.

The fundamental object is Tree:


Tree[a, {b, Tree[c, {d, e}], f, g}]

Tree takes two arguments: a payload (which can be any expression), and a list of subtrees. (And, yes, trees are by default rendered slightly green, in a nod to their botanical analogs.)

There are a variety of *Tree functions for constructing trees, and Tree* functions for converting trees to other things. RulesTree, for example, constructs a tree from a nested collection of rules:


RulesTree[a -> {b, c -> {d, e}, f, g}]

And TreeRules goes the other way, converting a tree to a nested collection of rules:



ExpressionTree creates a tree from the structure of an expression:


ExpressionTree[Integrate[1/(x^2 - 1), x]]

In a sense, this is a direct representation of a FullForm expression, as shown, for example, in TreeForm. But there are also ways to turn an expression into a tree. This takes the nodes of the tree to contain full subexpressionsso that the expressions on a given level in the tree are essentially what a function like Map would consider to be the expressions at that level (with HeadsTrue):


ExpressionTree[Integrate[1/(x^2 - 1), x], "Subexpressions"]

Heres another version, now effectively removing the redundancy of nested subexpressions, and treating heads of expressions just like other parts (in S-expression style):


ExpressionTree[Integrate[1/(x^2 - 1), x], "Atoms"]

Why do we need Tree when we have Graph? The answer is that there are several special features of trees that are important. In a Graph, for example, every node has a name, and the names have to be unique. In a tree, nodes dont have to be named, but they can have payloads that dont have to be unique. In addition, in a graph, the edges at a given node dont appear in any particular order; in a tree they do. Finally, a tree has a specific root node; a graph doesnt necessarily have anything like this.

When we were designing Tree we at first thought wed have to have separate symbolic representations of whole trees, subtrees and leaf nodes. But it turned out that we were able to make an elegant design with Tree alone. Nodes in a tree typically have the form Tree[payload, {child1, child2, …}] where the childi are subtrees. A node doesn’t necessarily have to have a payload, in which case it can just be given as Tree[{child1, child2, …}]. A leaf node is then Tree[expr, None] or Tree[None].

One very nice feature of this design is that trees can immediately be constructed from subtrees just by nesting expressions:


DynamicModuleBox[{Typeset`tree= HoldComplete[
Tree[$CellContext`a, {
Tree[$CellContext`b, None], 
Tree[$CellContext`c, {
Tree[$CellContext`d, None], 
Tree[$CellContext`e, None]}]}]]}, {
{RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765],
 AbsoluteThickness[1], Opacity[0.7], 
 LineBox[{{0.4472135954999579, 1.7888543819998317`}, {0., 
 LineBox[{{0.4472135954999579, 1.7888543819998317`}, {
 0.8944271909999159, 0.8944271909999159}}], 
 LineBox[{{0.8944271909999159, 0.8944271909999159}, {
 0.4472135954999579, 0.}}], 
 LineBox[{{0.8944271909999159, 0.8944271909999159}, {
 1.3416407864998738`, 0.}}]},
 0.403921568627451, 0.8705882352941177, 
{GrayLevel[0], EdgeForm[{GrayLevel[0], Opacity[0.7]}], 
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {0.4472135954999579, 1.7888543819998317}], 
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {0., 0.8944271909999159}], InsetBox[
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {0.8944271909999159, 0.8944271909999159}], 
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {0.4472135954999579, 0.}], InsetBox[
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {1.3416407864998738, 0.}]},
 0.403921568627451, 0.8705882352941177, 
 FrontEnd`GraphicsHighlightColor -> 
 0.403921568627451, 0.8705882352941177, 0.7176470588235294]},
ImageSize->{69.1171875, Automatic}]\), \!\(\*
DynamicModuleBox[{Typeset`tree= HoldComplete[
Tree[$CellContext`a, {
Tree[$CellContext`b, None], 
Tree[$CellContext`c, {
Tree[$CellContext`d, None], 
Tree[$CellContext`e, None]}]}]]}, {
{RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765],
 AbsoluteThickness[1], Opacity[0.7], 
 LineBox[{{0.4472135954999579, 1.7888543819998317`}, {0., 
 LineBox[{{0.4472135954999579, 1.7888543819998317`}, {
 0.8944271909999159, 0.8944271909999159}}], 
 LineBox[{{0.8944271909999159, 0.8944271909999159}, {
 0.4472135954999579, 0.}}], 
 LineBox[{{0.8944271909999159, 0.8944271909999159}, {
 1.3416407864998738`, 0.}}]},
 0.403921568627451, 0.8705882352941177, 
{GrayLevel[0], EdgeForm[{GrayLevel[0], Opacity[0.7]}], 
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {0.4472135954999579, 1.7888543819998317}], 
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {0., 0.8944271909999159}], InsetBox[
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {0.8944271909999159, 0.8944271909999159}], 
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {0.4472135954999579, 0.}], InsetBox[
 0.9607843137254902, 0.9882352941176471, 
RGBColor[0.6588235294117647, 0.7294117647058823, 0.7058823529411765], 
StripOnInput->False], {1.3416407864998738, 0.}]},
 0.403921568627451, 0.8705882352941177, 
 FrontEnd`GraphicsHighlightColor -> 
 0.403921568627451, 0.8705882352941177, 0.7176470588235294]},
ImageSize->{68.625, Automatic}]\), 

By the way, we can turn this into a generic Graph object with TreeGraph:



Notice that since Graph doesnt pay attention to ordering of nodes, some nodes have effectively been flipped in this rendering. The nodes have also had to be given distinct names in order to preserve the tree structure:


Graph[CloudGet["http://wolfr.am/VAsb0AqA"], VertexLabels -> Automatic]

If theres a generic graph that happens to be a tree, GraphTree converts it to explicit Tree form:



RandomTree produces a random tree of a given size:



One can also make trees from nesting functions: NestTree produces a tree by nestedly generating payloads of child nodes from payloads of parent nodes:


NestTree[{f[#], g[#]} &, x, 2]

OK, so given a tree, what can we do with it? There are a variety of tree functions that are direct analogs of functions for generic expressions. For example, TreeDepth gives the depth of a tree:



TreeLevel is directly analogous to Level. Here were getting subtrees that start at level 2 in the tree:


TreeLevel[CloudGet["http://wolfr.am/VAsbnJeT"], {2}]

How do you get a particular subtree of a given tree? Basically it has a position, just as a subexpression would have a position in an ordinary expression:


TreeExtract[CloudGet["http://wolfr.am/VAsbnJeT"], {2, 2}]

TreeSelect lets you select subtrees in a given tree:


TreeSelect[CloudGet["http://wolfr.am/VAsbnJeT"], TreeDepth[#] > 2 &]

TreeData picks out payloads, by default for the roots of trees (TreeChildren picks out subtrees):


TreeData /@ %

There are also TreeCases, TreeCount and TreePositionwhich by default search for subtrees whose payloads match a specified pattern. One can do functional programming with trees just like with generic expressions. TreeMap maps a function over (the payloads in) a tree:


TreeMap[f, CloudGet["http://wolfr.am/VAsbCysJ"]]

TreeFold does a slightly more complicated operation. Here f is effectively accumulating data by scanning the tree, with g being applied to the payload of each leaf (to initialize the accumulation):


TreeFold[{f, g}, CloudGet["http://wolfr.am/VAsbCysJ"]]

There are lots of things that can be represented by trees. A classic example is family trees. Heres a case where theres built-in data we can use:


Entity["Person", "QueenElizabethII::f5243"][
 EntityProperty["Person", "Children"]]

This constructs a 2-level family tree:


NestTree[#[EntityProperty["Person", "Children"]] &, 
 Entity["Person", "QueenElizabethII::f5243"], 2]

By the way, our Tree system is very scalable, and can happily handle trees with millions of nodes. But in Version 12.3 were really just starting out; in subsequent versions therell be all sorts of other tree functionality, as well as applications to parse trees, XML trees, etc.

Trees Continue to Grow (December 2021)

We introduced Tree as a basic construct in Version 12.3. In 13.0 were extending Tree and adding some enhancements. First of all, there are now options for tree layout and visualization.

For example, this lays out a tree radially (note that knowing its a tree rather than a general graph makes it possible to do much more systematic embeddings):


This adds options for styling elements, with one particular element specified by its tree position being singled out as blue:


One of the more sophisticated new tree concepts is TreeTraversalOrder. Imagine youre going to map across a tree. In what order should you visit the nodes? Heres the default behavior. Set up a tree:


Now show in which order the nodes are visited by TreeScan:


This explicitly labels the nodes in the order they are visited:


This order is by default depth first. But now TreeTraversalOrder allows you to ask for other orderings. Heres breadth-first order:


Heres a slightly more ornate ordering:


Why does this matter? Traversal order turns out to be related to deep questions about evaluation processes and what I now call multicomputation. In a sense a traversal order defines the reference frame through which an observer of the tree samples it. And, yes, that language sounds like physics, and for a good reason: this is all deeply related to a bunch of concepts about fundamental physics that arise in our Physics Project. And the parametrization of traversal orderapart from being useful for a bunch of existing algorithmsbegins to open the door to connecting computational processes to ideas from physics, and new notions about what Im calling multicomputation.


 RSS- (RSS-) — RSSfeedReader
cookie javascript.
: 9
• Digital Humanities, Other Application Areas, Recreational Computation… (1)
• Featured, Mathematica News, New Technology, Wolfram Language (1)
• Mathematica News, Wolfram Language, Wolfram News (5)
• Other Application Areas, Recreational Computation, Wolfram Community (1)
• Other Application Areas, Recreational Computation, Wolfram Language (1)
• 2022-06-30,  (1)
• 2022-06-24,  (1)
• 2022-06-16,  (1)
• 2022-06-10,  (1)
• 2022-06-02,  (1)
• 2022-05-27,  (1)
• 2022-05-20,  (1)
• 2022-05-07,  (1)
• 2022-04-22,  (1)
• Eryn Gillam (1)
• Mark Long (1)
• Robert Mendelsohn (1)
• Stephen Wolfram (6)